IP Library Granted Patent US 10,745,702
Granted Patent B2
US 10,745,702 · App. 15/564,288 · Granted Aug 18, 2020

Compositions and methods for inhibiting expression of the LECT2 gene

Inventor: Gregory Hinkle (Plymouth, MA)
Assignee: ALNYLAM PHARMACEUTICALS, INC.
C12N15/1136A61K31/712A61K31/7125A61K47/26A61P17/00A61P25/28A61P1/16C12N2310/11C12N2310/315C12N2310/321C12N2310/322C12N2310/335C12N2310/351C12N2310/3521C12N2310/3533
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,745,702
App. No.
15/564,288
Granted
Aug 18, 2020
Kind
B2
Abstract

The invention relates to antisense polynucleotide agents targeting the LECT2 gene, and methods of using such antisense polynucleotide agents to inhibit expression of LECT2 and to treat subjects having a LECT2-associated disease, e.g., amyloidosis.

Claims (31)

1. A single-stranded antisense polynucleotide agent for inhibiting expression of LECT2, wherein the agent comprises at least 8 contiguous nucleotides differing by no more than 3 nucleotides from the sequence of GCACAUGCGAUUGUAUGCCA (SEQ ID NO: 258), and wherein at least one of the contiguous nucleotides is a modified nucleotide.

2. The agent of claim 1 , which is 10 to 40 nucleotides in length.

3. The agent of claim 1 , wherein the modified nucleotide comprises a modified sugar moiety selected from the group consisting of: a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

4. The agent of claim 1 ,

wherein the agent is a gapmer comprising a gap segment comprised of linked 2′-deoxynucleotides positioned between a 5′ and a 3′ wing segment.

5. The agent of claim 4 , wherein the 5′-wing segment is 1, 2, 3, 4, 5, or 6 nucleotides in length.

6. The agent of claim 4 , wherein the 3′-wing segment is 1, 2, 3, 4, 5, or 6 nucleotides in length.

7. The agent of claim 4 , wherein the gap segment is 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length.

8. The agent of claim 1 , wherein the agent further comprises a ligand.

9. The agent of claim 8 , wherein the agent is conjugated to the ligand at the 3′-terminus, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

10. The agent of claim 9 , wherein the ligand is

11. A pharmaceutical composition for inhibiting expression of a LECT2 gene comprising the agent of claim 1 .

12. A pharmaceutical composition comprising the agent of claim 1 , and a lipid formulation, wherein the lipid formulation comprises an LNP or an MC3.

13. A method of inhibiting LECT2 expression in a cell, the method comprising:

(a) contacting the cell with the agent of claim 1 ; and

(b) maintaining the cell produced in step (a) for a time sufficient to obtain antisense inhibition of a LECT2 gene, thereby inhibiting expression of the LECT2 gene in the cell.

14. The agent of claim 1 , which is 10 to 30 nucleotides in length.

15. The agent of claim 1 , which is 18 to 30 nucleotides in length.

16. The agent of claim 1 , which is 10 to 24 nucleotides in length.

17. The agent of claim 1 , which is 18 to 24 nucleotides in length.

18. The agent of claim 1 , which is 14 or 20 nucleotides in length.

19. The agent of claim 1 , wherein the modified nucleotide is a 5-methylcytosine.

20. The agent of claim 1 , wherein the modified nucleotide comprises a modified internucleoside linkage.

21. The agent of claim 1 , which comprises a plurality of 2′-deoxynucleotides flanked on each side by at least one nucleotide having a modified sugar moiety.

22. The agent of claim 21 , wherein the modified sugar moiety is selected from the group consisting of a 2′-O-methoxyethyl modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, and a bicyclic sugar moiety.

23. The agent of claim 1 , wherein the agent comprises at least 12 contiguous nucleotides differing by no more than 3 nucleotides from the sequence of GCACAUGCGAUUGUAUGCCA (SEQ ID NO: 258).

24. The agent of claim 1 , wherein the agent comprises at least 11 contiguous nucleotides of the sequence of GCACAUGCGAUUGUAUGCCA (SEQ ID NO: 258).

25. The agent of claim 1 , wherein the agent comprises the sequence of GCACAUGCGAUUGUAUGCCA (SEQ ID NO: 258).

26. The agent of claim 1 , wherein the agent comprises the sequence and modifications of gscsascsasdTsdGs(5MdC)sdGsdAsdTsdTsdGsdTsdAsusgscscsa (SEQ ID NO: 66).

27. The agent of claim 1 , wherein the agent consists of the sequence of GCACAUGCGAUUGUAUGCCA (SEQ ID NO: 258).

28. The agent of claim 1 , wherein the agent consists of the sequence and modifications of gscsascsasdTsdGs(5MdC)sdGsdAsdTsdTsdGsdTsdAsusgscscsa (SEQ ID NO: 66).

Assignments (2)
SECURITY INTEREST Recorded Oct 1, 2025
From: ALNYLAM PHARMACEUTICALS, INC.; SIRNA THERAPEUTICS, INC.
To: BANK OF AMERICA, N.A.
Reel/Frame 072996/0337 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jul 9, 2018
From: HINKLE, GREGORY
To: ALNYLAM PHARMACEUTICALS, INC.
Reel/Frame 046293/0954 →