IP Library Granted Patent US 10,487,326
Granted Patent B2
US 10,487,326 · App. 15/827,431 · Granted Nov 26, 2019

Peptide oligonucleotide conjugates

Inventor: Gunnar J. Hanson (Cambridge, MA)
Assignee: SAREPTA THERAPEUTICS, INC.
C12N15/113A61K31/712A61K31/713A61K47/64A61K47/645C12N15/1136C12N15/1138C12N15/87C12N2310/11C12N2310/3233C12N2310/33C12N2310/3513C12N2320/33
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,487,326
App. No.
15/827,431
Granted
Nov 26, 2019
Kind
B2
Abstract

Oligonucleotide analogs conjugated to carrier peptides are provided. The disclosed compounds are useful for the treatment of various diseases, for example diseases where inhibition of protein expression or correction of aberrant mRNA splice products produces beneficial therapeutic effects.

Claims (68)

1. A conjugate comprising:

(a) a carrier peptide comprising amino acid subunits, the carrier peptide comprising a glycine (G) amino acid subunit at the carboxy terminus of the carrier peptide;

(b) a nucleic acid analogue comprising a substantially uncharged backbone and a targeting base sequence for sequence-specific binding to a target nucleic acid, wherein the nucleic acid analog is 8 to 40 bases in length; and

(c) a covalent attachment between the nucleic acid analog and the carrier peptide, the covalent attachment comprising the carboxy-terminal glycine and an optional linker group; wherein:

two or more of the amino acid subunits are positively charged amino acids, no more than seven contiguous amino acid subunits are arginine, and the covalent attachment between the nucleic acid analog and the carrier peptide is not 6-aminohexanoic acid or β-alanine.

2. The conjugate of claim 1 , wherein the nucleic acid analog is 8 to 20 bases in length.

3. The conjugate of claim 1 , wherein the nucleic acid analog is 8 to 16 bases in length.

4. The conjugate of claim 1 , wherein the nucleic acid analog is 10 to 30 bases in length.

5. The conjugate of claim 1 , wherein the nucleic acid analog is 12 to 25 bases in length.

6. The conjugate of claim 1 , wherein the nucleic acid analog is 8 to 12 bases in length.

7. The conjugate of claim 1 , wherein the carrier peptide is selected from SEQ ID NOS: 60, 69, 70, 89-121, 125, 130-160, 162-257, 276, 277, 281-288, 293-297, 300, 302-412, 419-552, and 554-566.

8. The conjugate of claim 1 , wherein the carrier peptide is selected from SEQ ID NOS: 130, 157-160, 251, 256, 386-388, and 540.

9. The conjugate of claim 1 , wherein the carrier peptide is SEQ ID NO: 159.

10. The conjugate of claim 1 , wherein the carrier peptide is of a formula selected from:

wherein:

Y is an integer from 4 to 7; and

R is selected from H, acetyl, benzoyl, and stearoyl.

11. The conjugate of claim 10 , wherein the carrier peptide is of the formula:

and Y is 6.

12. The conjugate of claim 1 , wherein the conjugate is selected from:

or a pharmaceutically acceptable salt of either of the foregoing, wherein:

X is an integer from 6 to 38;

R is selected from H, acetyl, benzoyl, and stearoyl;

R 1 is selected from H, acetyl, benzoyl, and stearoyl;

R 2 is selected from H, acetyl, benzoyl, stearoyl, trityl, and 4-methoxytrityl;

each Pi is a purine or pyrimidine base-pairing moiety which taken together form a targeting base sequence; and

the carrier peptide is selected from SEQ ID NOS: 60, 69, 70, 89-121, 125, 130-160, 162-257, 276, 277, 281-288, 293-297, 300, 302-412, 419-552, and 554-566,

wherein Xaa is the carboxy-terminal glycine.

13. The conjugate of claim 12 , wherein X is 6 to 18.

14. The conjugate of claim 12 , wherein X is 6 to 14.

15. The conjugate of claim 12 , wherein X is 8 to 28.

16. The conjugate of claim 12 , wherein X is 10 to 23.

17. The conjugate of claim 12 , wherein X is 6 to 10.

18. The conjugate of claim 12 , wherein the carrier peptide is selected from SEQ ID NOS: 130, 157-160, 251, 256, 386-388, and 540.

19. The conjugate of claim 12 , wherein the carrier is SEQ ID NO: 159.

20. The conjugate of claim 12 , wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine, and inosine.

21. A conjugate selected from:

or a pharmaceutically acceptable salt of any of the foregoing, wherein:

X is an integer from 6 to 38;

Y is an integer from 4 to 9;

Z is 6 or 9;

R is selected from H, acetyl, benzoyl, and stearoyl;

R 1 is selected from H, acetyl, benzoyl, and stearoyl;

R 2 is selected from H, acetyl, benzoyl, stearoyl, trityl, and 4-methoxytrityl; and

each Pi is a purine or pyrimidine base-pairing moiety which taken together form a targeting base sequence.

22. The conjugate of claim 21 , wherein X is 6 to 18.

23. The conjugate of claim 21 , wherein X is 6 to 14.

24. The conjugate of claim 21 , wherein X is 8 to 28.

25. The conjugate of claim 21 , wherein X is 10 to 23.

26. The conjugate of claim 21 , wherein X is 6 to 10.

27. The conjugate of claim 21 , wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine, and inosine.

28. The conjugate of claim 21 , wherein the compound is:

or a pharmaceutically acceptable salt thereof.

29. The conjugate of claim 28 , wherein R is H.

30. The conjugate of claim 28 , wherein R is acetyl.

31. The conjugate of claim 28 , wherein X is 6 to 18.

32. The conjugate of claim 28 , wherein X is 6 to 14.

33. The conjugate of claim 28 , wherein X is 8 to 28.

34. The conjugate of claim 28 , wherein X is 10 to 23.

35. The conjugate of claim 28 , wherein X is 6 to 10.

36. The conjugate of claim 28 , wherein each Pi is independently selected from adenine, cytosine, guanine, uracil, thymine, and inosine.

37. The conjugate of claim 1 , wherein the conjugate is the compound of the formula:

EG3-M23D-G(R) 6

wherein M23D is a nucleic acid analogue having the sequence GGCCAAACCTCGGCTTACCTGAAAT (SEQ ID No. 15);

EG3 is

linked to the 5′ end of the oligomer via a piperazine linker;

G is glycine; and

R is arginine.

Assignments (3)
SECURITY INTEREST Recorded May 7, 2025
From: SAREPTA THERAPEUTICS, INC.
To: JPMORGAN CHASE BANK, N.A. AS ADMINISTRATIVE AGENT
Reel/Frame 071218/0445 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 28, 2019
From: HANSON, GUNNAR J.
To: AVI BIOPHARMA, INC.
Reel/Frame 048159/0587 →
CHANGE OF NAME Recorded Jan 28, 2019
From: AVI BIOPHARMA, INC.
To: SAREPTA THERAPEUTICS, INC.
Reel/Frame 048175/0602 →