Cell penetrating peptide inhibitors of p53-MDM2 interaction

1. A compound having the Formula I or II:

or a pharmaceutically acceptable salt thereof, wherein:

each Ba is independently selected from adenine (A), guanine (G), cytosine (C), and thymine (T);

X is O or S;

q is 9;

s is an integer from 1 to 10;

y is an integer from 1 to 10;

z is an integer from 1 to 10;

each X 1 is independently selected from Leu, Val, and Ala;

each X 2 is independently selected from Thr and Ser;

each X 3 is Phe;

each X 4 is independently selected from Aib, Ala, and Glu;

each X 5 is independently selected from Glu, Asp, and His;

each X 6 is independently selected from Tyr, Phe, and Ser;

each X 7 is Trp;

each X 8 is independently selected from Aib, Ala, and Val;

each X 9 is independently selected from Gln and Asn;

each X 10 is Leu;

each X 11 is independently selected from Aib, Thr, and Ala;

each X 12 is independently selected from Ser and Thr;

each X 13 is independently selected from Ala and Gly; and

each X 14 is independently selected from Ala and Gly.

2. The compound of claim 1 , wherein X is S.

3. The compound of claim 1 , wherein s is an integer from 1 to 8.

4. The compound of claim 1 , wherein s is 6.

5. The compound of claim 1 , wherein y is an integer from 1 to 6.

6. The compound of claim 1 , wherein y is 4.

7. The compound of claim 1 , wherein z is an integer from 1 to 4.

8. The compound of claim 1 , wherein z is 1.

9. The compound of claim 1 , wherein the thiophosphate oligonucleotide sequence is TCCATGAGCTTCCTGATGCT (SEQ ID NO.:1).

10. The compound of claim 1 , wherein the compound is of the Formula:

or a pharmaceutically acceptable salt thereof.

11. A pharmaceutical composition comprising the compound of claim 1 , or a pharmaceutically acceptable salt thereof; and a pharmaceutically acceptable carrier.

12. A method of delivering a peptide inhibitor of p53-MDM2 into a cell target comprising treating the cell with a compound of claim 1 .