RNAi agents for inhibiting expression of alpha-ENaC and methods of use
View Patent ↗Described are RNAi agents, compositions that include RNAi agents, and methods for inhibition of an alpha-ENaC (SCNN1A) gene. The alpha-ENaC RNAi agents and RNAi agent conjugates disclosed herein inhibit the expression of an alpha-ENaC gene. Pharmaceutical compositions that include one or more alpha-ENaC RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the described alpha-ENaC RNAi agents to epithelial cells, such as pulmonary epithelial cells, in vivo, provides for inhibition of alpha-ENaC gene expression and a reduction in ENaC activity, which can provide a therapeutic benefit to subjects, including human subjects.
1. An RNAi agent for inhibiting expression of an alpha-ENaC gene, comprising:
an antisense strand comprising the nucleotide sequence (5′→3′) UAUUUGUUCUGGUUGCACAGG (SEQ ID NO:3); and
a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand;
wherein all or substantially all of the nucleotides of the sense strand and the antisense strand are modified nucleotides.
2. The RNAi agent of claim 1 , wherein the antisense strand, the sense strand, or both the antisense and sense strands includes at least one modified internucleoside linkage.
3. The RNAi agent of claim 1 , wherein the modified nucleotides are each independently selected from the group consisting of: 2′-O-methyl nucleotides, 2′-fluoro nucleotides, 2′-deoxy nucleotides, 2′,3′-seco nucleotide mimics, locked nucleotides, 2′-F-arabino nucleotides, 2′-methoxyethyl nucleotides, abasic nucleotides, ribitols, inverted nucleotides, inverted 2′-O-methyl nucleotides, inverted 2′-deoxy nucleotides, 2′-amino-modified nucleotides, 2′-alkyl-modified nucleotides, morpholino nucleotides, vinyl phosphonate containing nucleotides, cyclopropyl phosphonate containing nucleotides, and 3′-O-methyl nucleotides.
4. The RNAi agent of claim 1 , wherein all or substantially all of the nucleotides are modified with 2′-O-methyl nucleotides, 2′-fluoro nucleotides, or combinations thereof.
5. The RNAi agent of claim 1 , wherein the sense strand comprises the nucleotide sequence of (5′→3′) CCUGUGCAACCAGAACAAAUA (SEQ ID NO:5).
6. The RNAi agent of claim 1 , wherein the RNAi agent is linked to a targeting ligand.
7. The RNAi agent of claim 5 , wherein the RNAi agent is linked to a targeting ligand.
8. The RNAi agent of claim 6 , wherein the targeting ligand comprises an integrin targeting ligand.
9. The RNAi agent of claim 8 , wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
10. The RNAi agent of claim 9 , wherein the targeting ligand is conjugated to the sense strand.
11. The RNAi agent of claim 10 , wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.
12. The RNAi agent of claim 10 , wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
13. The RNAi agent of claim 12 , wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
14. The RNAi agent of claim 13 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
15. The RNAi agent of claim 10 , wherein the RNAi agent has two blunt ends.
16. The RNAi agent of claim 10 , wherein the sense strand comprises a terminal cape.
17. The RNAi agent of claim 16 , wherein the sense strand comprises one or two inverted abasic residues.
18. The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′):
(SEQ ID NO: 2)
usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg; or
(SEQ ID NO: 10)
cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg;
wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage, and cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine.
19. The RNAi agent of claim 18 , wherein the sense strand comprises the nucleotide sequence (5′→3′):
cscugugcaAfCfCfagaacaaaua (SEQ ID NO:4);
wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; and s represents a phosphorothioate linkage.
20. The RNAi agent of claim 19 , wherein the sense strand of the RNAi agent is linked to targeting ligand.
21. The RNAi agent of claim 20 , wherein the targeting ligand has affinity for a cell receptor expressed on an epithelial cell.
22. The RNAi agent of claim 20 , wherein the targeting ligand is an αvβ6 integrin targeting ligand.
23. A composition comprising the RNAi agent of claim 19 , wherein the composition comprises a pharmaceutically acceptable excipient.
24. The composition of claim 23 , further comprising a second RNAi agent for inhibiting the expression of alpha-ENaC.
25. The composition of claim 23 , further comprising one or more additional therapeutics.
26. The composition of claim 23 , wherein the composition is formulated for administration by inhalation.
27. The composition of claim 26 , wherein the composition is delivered by a metered-dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler.
28. A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of claim 1 .
29. The method of claim 28 , wherein the cell is within a subject.
30. The method of claim 29 , wherein the subject is a human subject.
31. The method of claim 28 , wherein the alpha-ENaC gene expression is inhibited by at least about 30%.
32. A method for inhibiting expression of an alpha-ENaC gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 23 .
33. The method of claim 32 , wherein the cell is within a subject.
34. The method of claim 33 , wherein the subject is a human subject.
35. The method of claim 32 , wherein the alpha-ENaC gene expression is inhibited by at least about 30%.
36. A method of treating one or more symptoms or diseases associated with enhanced or elevated ENaC activity levels, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 23 .
37. The method of claim 36 , wherein the disease is a respiratory disease.
38. The method of claim 37 , wherein the respiratory disease is cystic fibrosis, chronic bronchitis, non-cystic fibrosis bronchiectasis, chronic obstructive pulmonary disease (COPD), asthma, respiratory tract infections, primary ciliary dyskinesia, or lung carcinoma cystic fibrosis.
39. The method of claim 36 , wherein the disease is an ocular disease.
40. The method of claim 32 , wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight.
41. The method of claim 40 , wherein the RNAi agent is administered in two or more doses.
42. The method of claim 36 , wherein the RNAi agent is administered at a dose of about 0.001 mg/kg to about 0.500 mg/kg of body weight.
43. The method of claim 42 , wherein the RNAi agent is administered in two or more doses.
44. The RNAi agent of claim 19 , wherein the sense strand further includes an inverted abasic residue at the 3′ terminal end.
45. The RNAi agent of claim 44 , wherein the sense strand comprises the nucleotide sequence cscugugcaAfCfCfagaacaaauas (invAb) (SEQ ID NO:178), wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and (invAb) represents an inverted abasic residue.
46. The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) usAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:2), and the sense strand comprises the nucleotide sequence (5′→3′) cscugugcaAfCfCfagaacaaauas (invAb) (SEQ ID NO:178),
wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and (invAb) represents an inverted abasic residue.
47. The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) cPrpusAfsusUfuGfuUfcUfgGfuUfgCfaCfaGfsg (SEQ ID NO:10), and the sense strand comprises the nucleotide sequence (5′→3′) cscugugcaAfCfCfagaacaaauas (invAb) (SEQ ID NO:178),
wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and cPrpu represents a 5′-cyclopropyl phosphonate-2′-O-methyl uridine.
48. The RNAi agent of claim 45 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
49. The RNAi agent of claim 46 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
50. The RNAi agent of claim 47 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
51. The RNAi agent of claim 46 , wherein the sense strand of the RNAi agent is linked to an αvβ6 integrin targeting ligand.
52. The RNAi agent of claim 47 , wherein the sense strand of the RNAi agent is linked to an αvβ6 integrin targeting ligand.