IP Library Granted Patent US 11,001,900
Granted Patent B2
US 11,001,900 · App. 16/115,542 · Granted May 11, 2021

Method and system for characterization for female reproductive system-related conditions associated with microorganisms

Inventors: Zachary Apte (San Francisco, CA); Elisabeth Bik (San Francisco, CA); Sara W. Bird (San Francisco, CA); Luis E. Leon (Santiago, CL); Pamela A. Nieto (Santiago, CL); Victor Alegria-Mera (Santiago, CL); Cristian Bravo (Santiago, CL); Juan P. Cardenas (Santiago, CL); Paulo Covarrubias (Santiago, CL); Sarah L. Gupta (San Francisco, CA); Kira Harman (San Francisco, CA); Juan Jimenez (Santiago, CL); Felipe Melis-Arcos (Santiago, CL); Camila F. Navas (Santiago, CL); Harold Nunez (Santiago, CL); Eduardo Olivares (Santiago, CL); Nicolas Ordenes-Aenishanslins (Santiago, CL); Francisco J. Ossandon (San Francisco, CA); Ignacio Varas (Santiago, CL); Patricia Vera-Wolf (Santiago, CL); Donna Marie B. Hongo (San Francisco, CA); Laurens Kraal (San Francisco, CA); Nathaniel A. Walton (San Francisco, CA); Amanda Morton (San Francisco, CA); Juan P. Bustamante (Santiago, CL); Kwasi Addae (San Francisco, CA); Graham Gass (San Francisco, CA); Katia Soto-Liebe (Santiago, CL); Juan A. Ugalde (Santiago, CL); Eduardo H. Morales (Santiago, CL); Daniel Almonacid (San Francisco, CA); Jessica Richman (San Francisco, CA)
Assignee: PSOMAGEN, INC.
C12Q1/689C12Q1/04C12Q1/6883C12Q1/705C12Q1/708G16B5/00G16B20/00G16B30/00G16B40/00G16H10/40G16H50/20G16H50/30C12Q2600/106C12Q2600/112C12Q2600/16G16B40/20G16B40/30G16B50/30
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 11,001,900
App. No.
16/115,542
Granted
May 11, 2021
Kind
B2
Abstract

Embodiments of a method and/or system for characterizing one or more female reproductive system-related conditions can include determining a microorganism dataset associated with a set of subjects; and/or performing a characterization process associated with the one or more female reproductive system-related conditions, based on the microorganism dataset, where performing the characterization process can additionally or alternatively include performing a female reproductive system-related characterization process for the one or more female reproductive system-related conditions, and/or determining one or more therapies.

Claims (85)

1. A method for characterizing at least one female reproductive system-related condition associated with microorganisms, the method comprising:

determining a microorganism sequence dataset associated with a set of subjects based on microorganism nucleic acids from samples associated with the set of subjects, wherein the microorganism sequence dataset is usable for identifying microbiome features and the samples comprise at least one sample associated with the at least one female reproductive system-related condition;

collecting, for the set of subjects, supplementary data associated with the at least one female reproductive system-related condition;

determining a set of microbiome composition features based on the microorganism sequence dataset, wherein the set of microbiome composition features comprises a first subset of microbiome composition features associated with a set of bacterial targets;

generating a female reproductive system-related characterization model based on the supplementary data and the set of microbiome composition features, wherein the female reproductive system-related characterization model is associated with the at least one female reproductive system-related condition;

determining a female reproductive system-related characterization for a user for the at least one female reproductive system-related condition based on the female reproductive system-related characterization model; and

providing, based on the female reproductive system-related characterization, a therapy to the user for facilitating improvement of the at least one female reproductive system-related condition, the therapy being determined based on a therapy model and the user microbiome features,

wherein the at least one female reproductive system-related condition comprises at least one of bacterial vaginosis, cervicitis, pelvic inflammatory disease, idiopathic infertility, aerobic vaginitis, and infertility,

wherein the therapy comprises at least one of a consumable, a device-related therapy, a surgical operation, a psychological-associated therapy, and a behavior modification therapy.

2. The method of claim 1 ,

wherein the at least one female reproductive system-related condition further comprises an HPV infection,

wherein the set of microbiome composition features further comprises a second subset of microbiome features associated with a set of HPV targets;

wherein the set of bacterial targets comprises at least one of Aerococcus (genus), Aerococcus christensenii (species), Atopobium (genus), Atopobium vaginae (species), Chlamydia trachomatis (species), Dialister micraerophilus (species), Fusobacterium (genus), Fusobacterium nucleatum (species), Gardnerella (genus), Gardnerella vaginalis (species), Gemella (genus), Lactobacillus (genus), Lactobacillus iners (species), Lactobacillus jensenii (species), Megasphaera (genus), Mobiluncus (genus), Mobiluncus curtisii (species), Mobiluncus mulieris (species), Mycoplasma genitalium (species), Neisseria gonorrhoeae (species), Papillibacter (genus), Parvimonas (genus), Peptoniphilus (genus), Peptostreptococcus (genus), Porphyromonas (genus), Prevotella (genus), Prevotella amnii (species), Prevotella timonensis (species), Sneathia (genus), Staphylococcus aureus (species), Streptococcus agalactiae (species), and Treponema pallidum (species); and

wherein the set of HPV targets comprises at least one of HPV types 6, 11, 42, 43, 44, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.

3. The method of claim 1 ,

wherein the supplementary data indicates a lack of the at least one female reproductive system-related condition for a subset of subjects from the set of subjects,

wherein determining the set of microbiome features comprises determining healthy reference microbiome parameters ranges associated with the subset of subjects based on the microorganism sequence dataset, and

wherein generating the female reproductive system-related characterization model comprises generating the female reproductive system-related characterization model based on the supplementary data and the healthy reference microbiome parameters ranges.

4. The method of claim 1 ,

wherein the at least one female reproductive system-related condition comprises at least one of chlamydia, endometriosis, genital herpes, genital warts, gonorrhea, painful periods, polycystic ovarian syndrome, urinary tract infection, and yeast infection, and

wherein the set of microbiome composition features is associated with at least one of: Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22 , Alistipes sp. EBA6-25cl2 , Actinobacteria, Bacteroidales, Bacteroides, Bacteroidetes, Bacteroidia, Barnesiella, Barnesiella intestinihominis, Betaproteobacteria, Blautia luti, Blautia sp. Ser8 , Burkholderiales, Clostridia, Clostridiales, Collinsella, Coriobacteriales, Dorea, Dorea longicatena, Eggerthella, Eisenbergiella tayi, Faecalibacterium prausnitzii, Flavobacteriales, Flavobacteriia, Fusicatenibacter saccharivorans, Lachnospira pectinoschiza , Lactobacillaceae, Megasphaera, Odoribacter , Oscillospiraceae, Roseburia, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Subdoligranulum variabile , Sutterellaceae, Terrisporobacter, Bifidobacterium, Alistipes sp. HGB5 , Anaerostipes sp. 5_1_63FAA, Bacteroides acidifaciens, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Flavonifractor plautii, Fusicatenibacter, Hespellia, Moryella, Negativicutes, Selenomonadales , Veillonellaceae, Alistipes sp. RMA 9912, Bacteroides caccae, Bacteroides vulgatus, Bilophila sp. 4_1_30 , Intestinimonas , Prevotellaceae, Alistipes putredinis, Alistipes sp. NML05A004 , Alphaproteobacteria, Bacilli , Bacteroidaceae, Bacteroides sp. SLC1-38 , Blautia sp. YHC-4 , Blautia stercoris, Blautia wexlerae, Butyricimonas , Clostridiaceae, Clostridium, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriia, Dielma, Dorea formicigenerans, Eggerthella sp. HGA1 , Eisenbergiella, Faecalibacterium, Firmicutes , Flavobacteriaceae, Lactobacillales, Lactobacillus, Marvinbryantia, Odoribacter splanchnicus, Parabacteroides , Porphyromonadaceae, Rhodospirillales, Roseburia inulinivorans, Subdoligranulum , Acidaminococcaceae, Actinomycetales, Anaerococcus, Bacteroides sp. EBA5-17, Corynebacteriaceae, Corynebacteriales, Corynebacterium, Enterorhabdus, Erysipelatoclostridium , Erysipelotrichaceae, Erysipelotrichales, Erysipelotrichia, Oscillospira, Phascolarctobacterium, Proteobacteria, Sutterella wadsworthensis, Verrucomicrobiae , and Verrucomicrobiales.

5. The method of claim 1 , wherein providing the therapy comprises providing a recommendation for the therapy to the user at a computing device associated with the user.

6. A method for characterizing at least one female reproductive system-related condition associated with microorganisms, the method comprising:

collecting a sample from a user, wherein the sample comprises microorganism nucleic acids corresponding to the microorganisms associated with the at least one female reproductive system-related condition;

determining a microorganism dataset associated with the user based on the microorganism nucleic acids of the sample, the microorganism dataset including a microorganism sequence dataset usable for identifying microbiome features;

determining user microbiome composition features based on the microorganism dataset, wherein the user microbiome composition features are associated with the at least one female reproductive system-related condition, the user microbiome composition features comprising a first subset of microbiome composition features associated with a set of bacterial targets;

determining a female reproductive system-related characterization for the user for the at least one female reproductive system-related condition based on the user microbiome features; and

facilitating, based on the female reproductive system-related characterization, therapeutic intervention in relation to a therapy for the user for facilitating improvement of the at least one female reproductive system-related condition, the being determined based on a therapy model and the user microbiome features,

wherein the at least one female reproductive system-related condition comprises at least one of bacterial vaginosis, cervicitis, pelvic inflammatory disease, idiopathic infertility, aerobic vaginitis, and infertility,

wherein the therapy comprises at least one of a consumable, a device-related therapy, a surgical operation, a psychological-associated therapy, and a behavior modification therapy.

7. The method of claim 6 ,

wherein the at least one female reproductive system-related condition comprises an HPV infection;

wherein the user microbiome composition features further comprises a second subset of user microbiome composition features associated with a set of HPV targets;

wherein the set of bacterial targets comprises at least one of Aerococcus (genus), Aerococcus christensenii (species), Atopobium (genus), Atopobium vaginae (species), Chlamydia trachomatis (species), Dialister micraerophilus (species), Fusobacterium (genus), Fusobacterium nucleatum (species), Gardnerella (genus), Gardnerella vaginalis (species), Gemella (genus), Lactobacillus (genus), Lactobacillus iners (species), Lactobacillus jensenii (species), Megasphaera (genus), Mobiluncus (genus), Mobiluncus curtisii (species), Mobiluncus mulieris (species), Mycoplasma genitalium (species), Neisseria gonorrhoeae (species), Papillibacter (genus), Parvimonas (genus), Peptoniphilus (genus), Peptostreptococcus (genus), Porphyromonas (genus), Prevotella (genus), Prevotella amnii (species), Prevotella timonensis (species), Sneathia (genus), Staphylococcus aureus (species), Streptococcus agalactiae (species), and Treponema pallidum (species); and

wherein the set of HPV targets comprises at least one of HPV types 6, 11, 42, 43, 44, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.

8. The method of claim 6 ,

wherein the at least one female reproductive system-related condition comprises at least one of chlamydia, endometriosis, genital herpes, genital warts, gonorrhea, painful periods, polycystic ovarian syndrome, urinary tract infection, and yeast infection, and

wherein the user microbiome composition features are associated with at least one of: Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22 , Alistipes sp. EBA6-25cl2 , Actinobacteria, Bacteroidales, Bacteroides, Bacteroidetes, Bacteroidia, Barnesiella, Barnesiella intestinihominis, Betaproteobacteria, Blautia luti, Blautia sp. Ser8 , Burkholderiales, Clostridia, Clostridiales, Collinsella, Coriobacteriales, Dorea, Dorea longicatena, Eggerthella, Eisenbergiella tayi, Faecalibacterium prausnitzii, Flavobacteriales, Flavobacteriia, Fusicatenibacter saccharivorans, Lachnospira pectinoschiza , Lactobacillaceae, Megasphaera, Odoribacter , Oscillospiraceae, Roseburia, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Subdoligranulum variabile , Sutterellaceae, Terrisporobacter, Bifidobacterium, Alistipes sp. HGB5 , Anaerostipes sp. 5_1_63FAA, Bacteroides acidifaciens, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Flavonifractor plautii, Fusicatenibacter, Hespellia, Moryella, Negativicutes, Selenomonadales , Veillonellaceae, Alistipes sp. RMA 9912, Bacteroides caccae, Bacteroides vulgatus, Bilophila sp. 4_1_30 , Intestinimonas , Prevotellaceae, Alistipes putredinis, Alistipes sp. NML05A004 , Alphaproteobacteria, Bacilli , Bacteroidaceae, Bacteroides sp. SLC1-38 , Blautia sp. YHC-4 , Blautia stercoris, Blautia wexlerae, Butyricimonas , Clostridiaceae, Clostridium, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriia, Dielma, Dorea formicigenerans, Eggerthella sp. HGA1 , Eisenbergiella, Faecalibacterium, Firmicutes , Flavobacteriaceae, Lactobacillales, Lactobacillus, Marvinbryantia, Odoribacter splanchnicus, Parabacteroides , Porphyromonadaceae, Rhodospirillales, Roseburia inulinivorans, Subdoligranulum , Acidaminococcaceae, Actinomycetales, Anaerococcus, Bacteroides sp. EBA5-17, Corynebacteriaceae, Corynebacteriales, Corynebacterium, Enterorhabdus, Erysipelatoclostridium , Erysipelotrichaceae, Erysipelotrichales, Erysipelotrichia, Oscillospira, Phascolarctobacterium, Proteobacteria, Sutterella wadsworthensis, Verrucomicrobiae, Verrucomicrobiales.

9. The method of claim 8 ,

wherein the at least one female reproductive system-related condition comprises at least one of endometriosis, urinary tract infection, and yeast infection, and

wherein the user microbiome composition features is associated with at least one of: Actinobacteria, Alistipes sp. EBA6-25cl2 , Bacteroidales, Bacteroides, Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22 , Bacteroidetes, Bacteroidia, Barnesiella, Barnesiella intestinihominis, Betaproteobacteria, Blautia luti, Blautia sp. Ser8 , Burkholderiales, Clostridia, Clostridiales, Collinsella, Coriobacteriales, Dorea, Dorea longicatena, Eggerthella, Eisenbergiella tayi, Faecalibacterium prausnitzii, Flavobacteriales, Flavobacteriia, Fusicatenibacter saccharivorans, Lachnospira pectinoschiza , Lactobacillaceae, Megasphaera, Odoribacter , Oscillospiraceae, Roseburia, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Subdoligranulum variabile , Sutterellaceae, Terrisporobacter , Acidaminococcaceae, Actinomycetales, Anaerococcus, Anaerostipes sp. 5_1_63FAA, Bacilli , Bacteroidaceae, Bacteroides sp. EBA5-17, Bacteroides sp. SLC1-38, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Bifidobacterium, Blautia sp. YHC-4 , Butyricimonas , Clostridiaceae, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriia , Corynebacteriaceae, Corynebacteriales, Corynebacterium, Dorea formicigenerans, Eisenbergiella, Enterorhabdus, Erysipelatoclostridium , Erysipelotrichaceae, Erysipelotrichales, Erysipelotrichia, Firmicutes, Flavonifractor plautii, Fusicatenibacter, Hespellia , Lactobacillales, Lactobacillus, Marvinbryantia, Moryella, Negativicutes, Odoribacter splanchnicus, Oscillospira, Parabacteroides, Phascolarctobacterium , Prevotellaceae, Proteobacteria, Roseburia inulinivorans, Selenomonadales, Subdoligranulum, Sutterella wadsworthensis , Veillonellaceae, Verrucomicrobiae , and Verrucomicrobiales.

10. The method of claim 8 ,

wherein the at least one female reproductive system-related condition comprises at least one of painful periods and polycystic ovarian syndrome, and

wherein the user microbiome composition features are associated with at least one of: Actinobacteria, Alistipes putredinis, Alistipes sp. EBA6-25cl2 , Alistipes sp. NML05A004 , Alphaproteobacteria, Anaerostipes sp. 5_1_63FAA, Bacilli , Bacteroidaceae, Bacteroidales, Bacteroides, Bacteroides caccae, Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22, Bacteroides sp. SLC1-38, Bacteroides thetaiotaomicron, Bacteroidetes, Bacteroidia, Barnesiella intestinihominis, Blautia luti, Blautia sp. Ser8 , Blautia sp. YHC-4 , Blautia stercoris, Blautia wexlerae, Butyricimonas, Clostridia , Clostridiaceae, Clostridiales, Clostridium, Collinsella, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriales, Coriobacteriia, Dielma, Dorea formicigenerans, Dorea longicatena, Eggerthella, Eggerthella sp. HGA1 , Eisenbergiella, Eisenbergiella tayi, Faecalibacterium, Faecalibacterium prausnitzii, Firmicutes , Flavobacteriaceae, Flavobacteriales, Flavobacteriia, Flavonifractor plautii, Fusicatenibacter, Fusicatenibacter saccharivorans, Hespellia, Lachnospira pectinoschiza , Lactobacillaceae, Lactobacillales, Lactobacillus, Marvinbryantia, Megasphaera, Moryella, Odoribacter, Odoribacter splanchnicus , Oscillospiraceae, Parabacteroides , Porphyromonadaceae, Rhodospirillales, Roseburia inulinivorans, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Selenomonadales, Subdoligranulum, Subdoligranulum variabile , and Terrisporobacter.

11. The method of claim 8 ,

wherein the at least one female reproductive system-related condition comprises at least one of chlamydia, genital herpes, genital warts, and gonorrhea, and

wherein the user microbiome composition features are associated with at least one of: Bifidobacterium, Actinobacteria, Alistipes sp. HGB5 , Anaerostipes sp. 5_1_63FAA, Bacteroides acidifaciens, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Blautia luti, Faecalibacterium prausnitzii, Flavonifractor plautii, Fusicatenibacter, Fusicatenibacter saccharivorans, Hespellia, Lachnospira pectinoschiza, Moryella , Oscillospiraceae, Roseburia sp. 11SE39 , Subdoligranulum variabile, Clostridia, Clostridiales, Negativicutes, Selenomonadales , Veillonellaceae, Alistipes sp. RMA 9912, Bacteroides caccae, Bacteroides vulgatus, Bilophila sp. 4_1_30 , Intestinimonas , and Prevotellaceae.

12. The method of claim 6 , wherein the therapy comprises at least one of a consumable, a device-related therapy, a surgical operation, a psychological-associated therapy, and a behavior modification therapy, and wherein facilitating therapeutic intervention comprises providing a recommendation for the therapy to the user at a computing device associated with the user.

13. A method for characterizing at least one female reproductive system-related condition associated with microorganisms, the method comprising:

collecting a sample from a user, wherein the sample comprises microorganism nucleic acids corresponding to the microorganisms associated with the at least one female reproductive system-related condition;

determining a microorganism dataset associated with the user based on the microorganism nucleic acids of the sample, the microorganism dataset including a microorganism sequence dataset usable for identifying microbiome features;

determining user microbiome features based on the microorganism dataset, wherein the user microbiome features are associated with the at least one female reproductive system-related condition, the user microbiome composition features comprising a first subset of microbiome composition features associated with a set of bacterial targets; and

determining a female reproductive system-related characterization for the user for the at least one female reproductive system-related condition based on the user microbiome features; and

facilitating a therapy for the user for the at least one female reproductive system-related condition, the therapy being determined based on a therapy model and the user microbiome features,

wherein the at least one female reproductive system-related condition comprises at least one of bacterial vaginosis, cervicitis, pelvic inflammatory disease, idiopathic infertility, aerobic vaginitis, and infertility,

wherein the therapy comprises at least one of a consumable, a device-related therapy, a surgical operation, a psychological-associated therapy, and a behavior modification therapy.

14. The method of claim 13 , wherein determining the microorganism dataset comprises:

performing first primer-based amplification for bacterial targets associated with the at least one female reproductive system-related condition; and

performing second primer-based amplification for HPV targets associated with the at least one female reproductive system-related condition.

15. The method of claim 14 , wherein the HPV targets comprise at least one of HPV types 42, 39, 56, 35, 66, 33, and 42, and wherein performing the second primer-based amplification for the HPV targets comprises performing the second primer-based amplification with at least one of a first HPV-associated primer and a second HPV-associated primer, wherein the first HPV-associated primer comprises a first primer sequence comprising CGTCCTAAAGGGAATTGATC (SEQ ID NO: 78), and wherein the second HPV-associated primer comprises a second primer sequence comprising GCACAAGGCCATAATAATGG (SEQ ID NO: 63).

16. The method of claim 14 ,

wherein performing the second primer-based amplification for the HPV targets comprises performing the second primer-based amplification with a set of components comprising:

a set of primers associated with the L1 protein of the HPV targets, and

a set of synthetic dsDNA spike molecules of known concentration and comprising known scrambled nucleotide sequences with similar ATGC composition to at least one sequence region of the HPV targets;

wherein the user microbiome features comprise at least one ratio of sequencing reads between the HPV targets and the set of synthetic dsDNA spike molecules; and

wherein determining the female reproductive system-related characterization comprises determining the female reproductive system-related characterization for the user for the at least one female reproductive system-related condition based on the at least one ratio of sequencing reads between the HPV targets and the set of synthetic dsDNA spike molecules.

17. The method of claim 13 , wherein the at least one female reproductive system-related condition is associated with bacterial targets and HPV targets, and wherein determining the microorganism dataset comprises:

determining a first set of processed sequence reads associated with the bacterial targets based on filtering of a first set of sequence reads derived from the microorganism nucleic acids; and

determining a second set of processed sequence reads associated with the HPV targets based on filtering of a second set of sequence reads derived from the microorganism nucleic acids,

wherein determining the user microbiome features comprises determining the user microbiome features based on the first and the second set of processed sequence reads.

18. The method of claim 17 , wherein determining the user microbiome features comprises:

determining first alignment data based on alignment of the first set of processed sequence reads to 16S rRNA gene sequences associated with the bacterial targets;

determining second alignment data based on alignment of the second set of processed sequence reads to HPV sequences associated with the HPV targets; and

determining the user microbiome features based on the first and the second alignment data.

19. The method of claim 13 ,

wherein the at least one female reproductive system-related condition comprises an HPV infection and at least one of bacterial vaginosis, cervicitis, pelvic inflammatory disease, idiopathic infertility, aerobic vaginitis, and infertility,

wherein the user microbiome features comprises a first subset of user microbiome features associated with a set of bacterial targets, and a second subset of user microbiome features associated with a set of HPV targets,

wherein the set of bacterial targets comprises at least one of Aerococcus (genus), Aerococcus christensenii (species), Atopobium (genus), Atopobium vaginae (species), Chlamydia trachomatis (species), Dialister micraerophilus (species), Fusobacterium (genus), Fusobacterium nucleatum (species), Gardnerella (genus), Gardnerella vaginalis (species), Gemella (genus), Lactobacillus (genus), Lactobacillus iners (species), Lactobacillus jensenii (species), Megasphaera (genus), Mobiluncus (genus), Mobiluncus curtisii (species), Mobiluncus mulieris (species), Mycoplasma genitalium (species), Neisseria gonorrhoeae (species), Papillibacter (genus), Parvimonas (genus), Peptoniphilus (genus), Peptostreptococcus (genus), Porphyromonas (genus), Prevotella (genus), Prevotella amnii (species), Prevotella timonensis (species), Sneathia (genus), Staphylococcus aureus (species), Streptococcus agalactiae (species), and Treponema pallidum (species), and

wherein the set of HPV targets comprises at least one of HPV types 6, 11, 42, 43, 44, 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.

20. The method of claim 19 , wherein the set of bacterial targets comprises at least one of Actinomyces (genus), Alloiococcus (genus), Anaerococcus (genus), Anaeroglobus (genus), Anaerostipes (genus), Anaerotruncus (genus), Arcanobacterium (genus), Arthrospira (genus), Bacteroides (genus), Bulleidia (genus), Campylobacter (genus), Catenibacterium (genus), Coriobacteriaceae (family), Corynebacterium (genus), Dialister (genus), Eggerthella (genus), Enterococcus (genus), Escherichia (genus), Finegoldia (genus), Lactobacillaceae (family), Lactobacillales (order), Leptotrichia (genus), Moryella (genus), Mycoplasma (genus), Peptococcus (genus), Porphyromonadaceae (family), Prevotellaceae (family), Pseudomonas (genus), Ruminococcus (genus), Segniliparus (genus), Shigella (genus), Staphylococcus (genus), Streptococcus (genus), Treponema (genus), Ureaplasma (genus), Veillonella (genus), Veillonellaceae (family), Aerococcus spp. (genus), Algoriphagus aquatilis (species), Anaerococcus spp. (genus), Anaerococcus tetradius (species), Anaerococcus vaginalis (species), Anoxybacillus pushchinoensis (species), Atopobium spp. (genus), Bacteroides fragilis (species), Bacteroides spp. (genus), Bifidobacterium animalis subsp. lactis (species), Bifidobacterium dentium (species), Bifidobacterium lactis (species), Bifidobacterium longum subsp. suis (species), Bulleidia extructa (species), Burkholderia fungorum (species), Burkholderia phenoliruptrix (species), Caldicellulosiruptor saccharolyticus (species), Campylobacter spp. (genus), Campylobacter ureolyticus (species), Candida albicans (species), Candida glabrata (species), Candida krusei (species), Candida lusitaniae (species), Candidatus Mycoplasma girerdii (species), Catenibacterium spp. (genus), Chondromyces robustus (species), Clostridiales BVAB2 (species), Clostridiales BVAB3 (species), Clostridium cavendishii (species), Clostridium viride (species), Cryobacterium psychrophilum (species), Dickeya chrysanthemi (species), Eggerthia catenaformis (species), Erwinia chrysanthemi (species), Escherichia coli (species), Escherichia fergusonii (species), Exiguobacterium acetylicum (species), Fusobacterium spp. (genus), Gardnerella spp. (genus), Gemella sp. (genus), Haemophilus ducreyi (species), Klebsiella granulomatis (species), Lachnospiraceae BVAB1 (species), Lactobacillus acidophilus (species), Lactobacillus brevis (species), Lactobacillus casei (species), Lactobacillus casei Shirota (species), Lactobacillus crispatus (species), Lactobacillus delbrueckii (species), Lactobacillus fermentum (species), Lactobacillus gasseri (species), Lactobacillus johnsonii (species), Lactobacillus kefiranofaciens (species), Lactobacillus paracasei FJ861111.1 (species), Lactobacillus pentosus strain S-PT84 (species), Lactobacillus plantarum (species), Lactobacillus reuteri (species), Lactobacillus reuteri RC-14 (species), Lactobacillus rhamnosus (species), Lactobacillus rhamnosus (strain BMX 54) (species), Lactobacillus rhamnosus BMX 54 (species), Lactobacillus rhamnosus GR-1 (species), Lactobacillus salivarius (species), Lactobacillus vaginalis (species), Leptotrichia spp. (genus), Maribacter orientalis (species), Megasphaera genomosp (species), Megasphaera micronuciformis (species), Megasphaera spp. (genus), Microbacterium halophilum (species), Moorella glycerini (species), Mycoplasma hominis (species), Mycoplasma muris (species), Paeniclostridium sordellii (species), Papillibacter spp. (genus), Parastreptomyces abscessus (species), Parvimonas micra (species), Parvimonas spp. (genus), Pasteurella multocida (species), Pediococcus ethanolidurans (species), Peptoniphilus harei (species), Peptoniphilus indolicus (species), Peptoniphilus spp. (genus), Peptostreptococcus anaerobius (species), Peptostreptococcus massiliae (species), Peptostreptococcus spp. (genus), Porphyromonas gingivalis (species), Porphyromonas levii (species), Porphyromonas sp. (genus), Porphyromonas uenonis (species), Prevotella bivia (species), Prevotella disiens (species), Prevotella intermedia (species), Prevotella oralis (species), Prevotella oris (species), Pseudomonas spp. (genus), Ralstonia pickettii (species), Ruminococcus spp. (genus), Sanguibacter keddieii (species), Sneathia amnii (species), Sneathia sanguinegens (species), Sneathia spp. (genus), Staphylococcus mulans (species), Staphylococcus pasteuri (species), Staphylococcus simiae (species), Staphylococcus simulans (species), Staphylococcus spp. (genus), Staphylococcus warneri (species), Streptococcus anginosus (species), Streptococcus intermedius (species), Streptococcus pyogenes (species), Streptococcus viridans (species), Thermosipho atlanticus (species), Thermovirga lienii (species), Trichomonas vaginalis (species), Trueperella bernardiae (species), Ureaplasma parvum (species), Ureaplasma urealyticum (species), Veillonella montpellierensis (species), Veillonella parvula (species), Virgibacillus proomii (species), and Zobellia laminariae (species).

21. The method of claim 13 ,

wherein the at least one female reproductive system-related condition comprises at least one of chlamydia, endometriosis, genital herpes, genital warts, gonorrhea, painful periods, polycystic ovarian syndrome, urinary tract infection, and yeast infection, and

wherein the user microbiome features are associated with at least one of: Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22 , Alistipes sp. EBA6-25cl2 , Actinobacteria, Bacteroidales, Bacteroides, Bacteroidetes, Bacteroidia, Barnesiella, Barnesiella intestinihominis, Betaproteobacteria, Blautia luti, Blautia sp. Ser8 , Burkholderiales, Clostridia, Clostridiales, Collinsella, Coriobacteriales, Dorea, Dorea longicatena, Eggerthella, Eisenbergiella tayi, Faecalibacterium prausnitzii, Flavobacteriales, Flavobacteriia, Fusicatenibacter saccharivorans, Lachnospira pectinoschiza , Lactobacillaceae, Megasphaera, Odoribacter , Oscillospiraceae, Roseburia, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Subdoligranulum variabile , Sutterellaceae, Terrisporobacter, Bifidobacterium, Alistipes sp. HGB5 , Anaerostipes sp. 5_1_63FAA, Bacteroides acidifaciens, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Flavonifractor plautii, Fusicatenibacter, Hespellia, Moryella, Negativicutes, Selenomonadales , Veillonellaceae, Alistipes sp. RMA 9912, Bacteroides caccae, Bacteroides vulgatus, Bilophila sp. 4_1_30 , Intestinimonas , Prevotellaceae, Alistipes putredinis, Alistipes sp. NML05A004 , Alphaproteobacteria, Bacilli , Bacteroidaceae, Bacteroides sp. SLC1-38 , Blautia sp. YHC-4 , Blautia stercoris, Blautia wexlerae, Butyricimonas , Clostridiaceae, Clostridium, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriia, Dielma, Dorea formicigenerans, Eggerthella sp. HGA1 , Eisenbergiella, Faecalibacterium, Firmicutes , Flavobacteriaceae, Lactobacillales, Lactobacillus, Marvinbryantia, Odoribacter splanchnicus, Parabacteroides , Porphyromonadaceae, Rhodospirillales, Roseburia inulinivorans, Subdoligranulum , Acidaminococcaceae, Actinomycetales, Anaerococcus, Bacteroides sp. EBA5-17, Corynebacteriaceae, Corynebacteriales, Corynebacterium, Enterorhabdus, Erysipelatoclostridium , Erysipelotrichaceae, Erysipelotrichales, Erysipelotrichia, Oscillospira, Phascolarctobacterium, Proteobacteria, Sutterella wadsworthensis, Verrucomicrobiae, Verrucomicrobiales.

22. The method of claim 21 , wherein the sample is associated with a gut site, wherein the user microbiome features comprise site-specific composition features associated with the gut site, and wherein the site-specific composition features are associated with at least one of: Bacteroides sp. AR20, Bacteroides sp. AR29, Bacteroides sp. D22 , Alistipes sp. EBA6-25cl2 , Actinobacteria, Bacteroidales, Bacteroides, Bacteroidetes, Bacteroidia, Barnesiella, Barnesiella intestinihominis, Betaproteobacteria, Blautia luti, Blautia sp. Ser8 , Burkholderiales, Clostridia, Clostridiales, Collinsella, Coriobacteriales, Dorea, Dorea longicatena, Eggerthella, Eisenbergiella tayi, Faecalibacterium prausnitzii, Flavobacteriales, Flavobacteriia, Fusicatenibacter saccharivorans, Lachnospira pectinoschiza , Lactobacillaceae, Megasphaera, Odoribacter , Oscillospiraceae, Roseburia, Roseburia sp. 11SE39, Ruminococcaceae, Sarcina, Subdoligranulum variabile , Sutterellaceae, Terrisporobacter, Bifidobacterium, Alistipes sp. HGB5 , Anaerostipes sp. 5_1_63FAA, Bacteroides acidifaciens, Bacteroides thetaiotaomicron , Bifidobacteriaceae, Bifidobacteriales, Flavonifractor plautii, Fusicatenibacter, Hespellia, Moryella, Negativicutes, Selenomonadales , Veillonellaceae, Alistipes sp. RMA 9912, Bacteroides caccae, Bacteroides vulgatus, Bilophila sp. 4_1_30 , Intestinimonas , Prevotellaceae, Alistipes putredinis, Alistipes sp. NML05A004 , Alphaproteobacteria , Bacteroidaceae, Bacteroides sp. SLC1-38 , Blautia sp. YHC-4 , Blautia stercoris, Blautia wexlerae, Butyricimonas , Clostridiaceae, Clostridium, Collinsella aerofaciens , Coriobacteriaceae, Coriobacteriia, Dielma, Dorea formicigenerans, Eggerthella sp. HGA1 , Eisenbergiella, Faecalibacterium, Flavobacteriaceae, Lactobacillus, Marvinbryantia, Odoribacter splanchnicus, Parabacteroides, Rhodospirillales, Roseburia inulinivorans, Subdoligranulum , Acidaminococcaceae, Bacteroides sp. EBA5-17, Corynebacteriaceae, Corynebacteriales, Corynebacterium, Enterorhabdus, Erysipelatoclostridium , Erysipelotrichaceae, Erysipelotrichales, Erysipelotrichia, Firmicutes, Oscillospira, Phascolarctobacterium, Proteobacteria, Sutterella wadsworthensis, Verrucomicrobiae , and Verrucomicrobiales.

23. The method of claim 21 , wherein the sample is associated with a body site comprising at least one of a skin site, a genital site, a mouth site, and a nose site, wherein the user microbiome features comprise site-specific composition features associated with the body site, and wherein the site-specific composition features are associated with at least one of: Actinobacteria, Bacilli, Firmicutes , Lactobacillaceae, Lactobacillales, Lactobacillus , Porphyromonadaceae, Bacteroidales, Bacteroidia, Actinomycetales, Anaerococcus , Corynebacteriaceae, Corynebacteriales , and Corynebacterium.

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Jan 14, 2020
From: UBIOME, INC.
To: PSOMAGEN, INC.
Reel/Frame 051586/0274 →
Continuity (6)
Continuation In Part 15198818 · Jun 30, 2016
Provisional Application 62653402 · Apr 5, 2018
Provisional Application 62585131 · Nov 13, 2017
Provisional Application 62551155 · Aug 28, 2017
Provisional Application 62186793 · Jun 30, 2015
Related Publication 20190078142A1 · Mar 14, 2019