IP Library Granted Patent US 10,358,658
Granted Patent B2
US 10,358,658 · App. 16/201,836 · Granted Jul 23, 2019

Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Inventors: Jennifer A. Doudna (Berkeley, CA); Martin Jinek (Berkeley, CA); Krzysztof Chylinski (Vienna, AT); Emmanuelle Charpentier (Braunschweig, DE)
Assignees: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier
C12N15/907A01H6/4684A01K67/027A61K38/465C12N9/22C12N15/102C12N15/111C12N15/113C12N15/63C12N15/70C12N15/746C12N15/90C12N15/902A61K48/00C12N2310/11C12N2310/13C12N2310/14C12N2310/20C12N2310/31C12N2310/32C12N2310/33C12N2310/3519C12N2310/531C12N2800/80C12Y301/04
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,358,658
App. No.
16/201,836
Granted
Jul 23, 2019
Kind
B2
Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims (59)

1. A method of targeting and binding a target DNA, the method comprising:

contacting the target DNA with:

(a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA comprising, in 5′ to 3′ order:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

wherein the Cas9 protein and the single molecule DNA-targeting RNA form a complex that binds to the target DNA.

2. The method of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

3. The method of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide.

4. The method of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

5. The method of claim 1 , wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

6. The method of claim 1 , wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

7. The method of claim 1 , wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.

8. The method of claim 1 , wherein:

(a) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432); or

(b) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397); or

(c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432).

9. The method of claim 1 , wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

10. The method of claim 1 , wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.

11. The method of claim 10 , wherein the method comprises introducing into the cell

the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.

12. The method of claim 11 , wherein the nucleic acid that encodes the Cas9 protein is a DNA molecule.

13. The method of claim 11 , wherein the nucleic acid that encodes the Cas9 protein is an RNA molecule.

14. The method of claim 10 , wherein the method comprises introducing into the cell the nucleic acid that encodes the single-molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.

15. The method of claim 1 , wherein the target DNA is inside of a cell and the method comprises introducing a nucleic acid encoding the Cas9 protein into the cell, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.

16. A method of modifying a target DNA, the method comprising:

contacting the target DNA with:

(a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA comprising, in 5′ to 3′ order:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

wherein said contacting results in modification of the target DNA.

17. The method of claim 16 , wherein said modification is cleavage of the target DNA.

18. The method of claim 17 , wherein the target DNA is inside of a cell and the method further comprises introducing a donor polynucleotide into the cell.

19. The method of claim 18 , wherein a nucleotide sequence of the donor polynucleotide inserts into the target DNA, producing a genetically modified cell.

20. The method of claim 16 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.

21. The method of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide.

22. The method of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.

23. The method of claim 16 , wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

24. The method of claim 16 , wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).

25. The method of claim 16 , wherein the single molecule DNA-targeting RNA comprises one or more the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.

26. The method of claim 16 , wherein:

(a) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432); or

(b) the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397); or

(c) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432).

27. The method of claim 16 , wherein the method comprises contacting the target DNA with two or more single molecule DNA-targeting RNAs, wherein the two or more single molecule DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.

28. The method of claim 16 , wherein the target DNA is inside of a cell and the method comprises introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA.

29. The method of claim 28 , wherein the method comprises introducing into the cell the single molecule DNA-targeting RNA and a nucleic acid that encodes the Cas9 protein.

30. A method of cleaving a target DNA in a cell, the method comprising:

contacting the target DNA in the cell with:

(a) a Cas9 protein; and

(b) a single molecule DNA-targeting RNA comprising, in 5′ to 3′ order:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, wherein the nucleotide sequence that is complementary to the target sequence is 15-25 nucleotides (nt) long; and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,

wherein (i) and (ii) are covalently linked by intervening nucleotides,

wherein said contacting comprises: introducing into the cell the single molecule DNA-targeting RNA or a nucleic acid that encodes the single molecule DNA-targeting RNA, and introducing into the cell the Cas9 protein or a nucleic acid that encodes the Cas9 protein,

wherein said contacting results in cleavage of the target DNA.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 5, 2018
From: DOUDNA, JENNIFER A.; JINEK, MARTIN
To: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Reel/Frame 047685/0087 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Dec 5, 2018
From: CHYLINSKI, KRZYSZTOF
To: UNIVERSITY OF VIENNA
Reel/Frame 047685/0094 →
Continuity (6)
Continuation 13842859 · Mar 15, 2013
Provisional Application 61765576 · Feb 15, 2013
Provisional Application 61757640 · Jan 28, 2013
Provisional Application 61716256 · Oct 19, 2012
Provisional Application 61652086 · May 25, 2012
Related Publication 20190093129A1 · Mar 28, 2019
Cited By (5)
US 12,201,699 US 12,286,727 US 12,297,466 US 12,338,436 US 12,410,469