MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD
Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy.
1 - 65 . (canceled)
66 . An antisense oligonucleotide of 21 bases comprising a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA,
wherein the base sequence comprises 19 consecutive bases of
(SEQ ID NO: 431)
CTGTTGCCTCCGGTTCTGAAGGTGT,
wherein the antisense oligonucleotide is a morpholino oligomer, and
wherein the antisense oligonucleotide induces exon 53 skipping;
or a pharmaceutically acceptable salt thereof.
67 . A pharmaceutical composition comprising an antisense oligonucleotide of 21 bases comprising
a base sequence that is 100% complementary to 21 consecutive bases of exon 53 of the human dystrophin pre-mRNA,
wherein the base sequence comprises 19 consecutive bases of
(SEQ ID NO: 431)
CTGTTGCCTCCGGTTCTGAAGGTGT,
wherein the antisense oligonucleotide is a morpholino oligomer, and
wherein the antisense oligonucleotide induces exon 53 skipping;
or a pharmaceutically acceptable salt thereof; and
a pharmaceutically acceptable carrier.