Oligonucleotide compounds for targeting huntingtin mRNA
This disclosure relates to novel huntingtin targets. Novel oligonucleotides for the treatment of Huntington's disease are also provided.
1. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes an RNA duplex comprising a sense strand and an antisense strand wherein the sense strand is between 15 and 30 nucleotides in length and comprises a nucleotide sequence which is at least 80% identical to SEQ ID NO: 1056 and wherein antisense strand comprises a nucleotide sequence which is at least 85% identical to 5′UAAGCAUGGAGCUAGCAGGC3′ (SEQ ID NO: 328) and is complementary to at least 7 contiguous nucleotides of SEQ ID NO: 1056.
2. The vector of claim 1 wherein the antisense strand comprises no more than 3 mismatches with SEQ ID NO: 1056.
3. The vector of claim 1 wherein the antisense strand is complementary to at least 10 contiguous nucleotides of SEQ ID NO: 1056.
4. The vector of claim 1 wherein the antisense strand is complementary to at least 13 contiguous nucleotides of SEQ ID NO: 1056.
5. The vector of claim 4 , wherein the antisense strand comprises a nucleotide sequence which is at least 90% identical to 5′UAAGCAUGGAGCUAGCAGGC3′ (SEQ ID NO: 328); and wherein the sense strand is between 15 and 30 nucleotides in length and comprises a nucleotide sequence which is at least 85% identical to SEQ ID NO: 1056.
6. A recombinant adeno-associated viruses (rAAV) comprising the vector of claim 1 and an AAV capsid.
7. A pharmaceutical composition comprising the rAAV of claim 6 and a pharmaceutically acceptable carrier.
8. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes the RNA duplex of claim 1 .
9. A recombinant adeno-associated viruses (rAAV) comprising the vector of claim 8 and an AAV capsid.
10. A pharmaceutical composition comprising the rAAV of claim 9 and a pharmaceutically acceptable carrier.
11. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the RNA duplex of claim 1 or a vector comprising a nucleotide sequence encoding the RNA duplex of claim 1 .
12. A method for inhibiting expression of HTT gene in a cell, the method comprising introducing into the cell the RNA duplex of claim 1 or a vector comprising a nucleotide sequence encoding the RNA duplex of claim 1 .
13. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 6 .
14. The method of claim 13 , wherein the rAAV is administered to a putamen of the patient.
15. The method of claim 13 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.
16. The method of claim 13 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.
17. A method of treating Huntington's Disease in a patient, the method comprising administering to the patient a therapeutically effective amount of the rAAV of claim 9 .
18. The method of claim 17 , wherein the rAAV is administered to a putamen of the patient.
19. The method of claim 17 , wherein the rAAV is administered to one or more regions of the parenchyma of the brain, with at least one region being a putamen.
20. The method of claim 17 , wherein administering the rAAV to the patient causes a decrease in HTT gene mRNA in the striatum, the cortex, or both the striatum and the cortex of the patient.