Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A method of targeting and binding a target DNA in a prokaryotic cell, the method comprising:
contacting the target DNA inside of the prokaryotic cell with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and wherein the activator-RNA: (1) comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and/or (2) comprises a heterologous moiety,
wherein the complex binds to the target DNA.
2. The method of claim 1 , wherein the prokaryotic cell is a bacterial cell.
3. The method of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
4. The method of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide.
5. The method of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
6. The method of claim 1 , wherein the activator-RNA comprises the nucleic acid mimetic.
7. The method of claim 1 , wherein the activator-RNA comprises one or more of:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,
(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, or a 2′-dimethylaminoethoxyethoxy modified sugar moiety, and
(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).
8. The method of claim 1 wherein the activator-RNA comprises the non-natural internucleoside linkage and the modified sugar moiety.
9. The method of claim 1 , wherein the activator-RNA comprises the heterologous moiety.
10. The method of claim 9 , wherein the heterologous moiety is one or more of the following: a polyamine; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
11. The method of claim 1 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
12. The method of claim 1 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
13. The method of claim 1 , wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
14. The method of claim 1 , wherein said contacting comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the prokaryotic cell.
15. The method of claim 1 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
16. A method of cleaving a target DNA in a prokaryotic cell, the method comprising:
contacting the target DNA inside of the prokaryotic cell with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and wherein the activator-RNA: (1) comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase, and/or (2) comprises a heterologous moiety,
wherein said contacting results in cleavage of the target DNA.
17. The method of claim 16 , wherein the prokaryotic cell is a bacterial cell.
18. The method of claim 16 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
19. The method of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide.
20. The method of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
21. The method of claim 16 , wherein the activator-RNA comprises one or more of:
(1) the non-natural internucleoside linkage, which comprises a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage,
(2) the modified sugar moiety, which comprises a locked nucleic acid (LNA) sugar moiety, a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, or a 2′-dimethylaminoethoxyethoxy modified sugar moiety, and
(3) the nucleic acid mimetic, which comprises a peptide nucleic acid (PNA), a morpholino nucleic acid, or a cyclohexenyl nucleic acid (CeNA).
22. The method of claim 16 , wherein the activator-RNA comprises Hall the non-natural internucleoside linkage and the modified sugar moiety.
23. The method of claim 16 , wherein the activator-RNA comprises said heterologous moiety, which is one or more of the following heterologous moieties: an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
24. The method of claim 16 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
25. The method of claim 16 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
26. The method of claim 16 , wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
27. The method of claim 16 , wherein said contacting comprises introducing the Cas9 protein, an RNA molecule that encodes the Cas9 protein, or a DNA molecule that encodes the Cas9 protein into the prokaryotic cell.
28. The method of claim 16 , wherein the method comprises introducing a donor polynucleotide into the prokaryotic cell.
29. The method of claim 16 , wherein the Cas9 protein comprises a mutation in a RuvC domain and/or an HNH domain.
30. A method of targeting and binding a target DNA in a prokaryotic cell, the method comprising:
contacting the target DNA inside of the prokaryotic cell with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the activator-RNA and the targeter-RNA are conjugated to a heterologous moiety,
wherein said contacting results in modification of the target DNA.
31. A method of targeting and binding a target DNA, the method comprising:
contacting a target DNA in a prokaryotic cell with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising: a first nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, and a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(ii) the activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the complex binds to the target DNA.
32. The method of claim 31 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
33. The method of claim 31 , wherein the Cas9 protein is fused to a heterologous polypeptide.
34. The method of claim 31 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
35. The method of claim 31 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
36. The method of claim 31 , wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
37. A method of modifying a target DNA, the method comprising:
contacting a target DNA in a prokaryotic cell with a complex that comprises:
(a) a Cas9 protein; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA comprising: a first nucleotide sequence that is complementary to, and hybridizes with, a target sequence of the target DNA, and a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(ii) the activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein said contacting results in modification of the target DNA.
38. The method of claim 37 , wherein said modification is cleavage of the target DNA.
39. The method of claim 38 , wherein a nucleotide sequence of a donor polynucleotide is integrated into the target DNA.
40. The method of claim 37 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15-25 nucleotides (nt) long.
41. The method of claim 37 , wherein the Cas9 protein is fused to a heterologous polypeptide.
42. The method of claim 37 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
43. The method of claim 37 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
44. The method of claim 37 , wherein the method comprises contacting the target DNA with two or more DNA-targeting RNAs, wherein the two or more DNA-targeting RNAs hybridize to different target sequences within the same or different target DNA molecules.
45. The method of claim 37 , wherein said contacting comprises introducing the Cas9 protein into the prokaryotic cell as protein.
46. The method of claim 37 , wherein contacting comprises introducing a nucleic acid that encodes the Cas9 protein into the prokaryotic cell.
47. The method of claim 37 , wherein said contacting comprises introducing a nucleic acid encoding the Cas9 protein into the prokaryotic cell, wherein the nucleic acid encoding the Cas9 protein comprises a nucleotide sequence modification that replaces one or more codons of a wild-type Cas9-encoding nucleotide sequence with one or more different codons encoding the same amino acid.
48. The method of claim 37 , wherein the prokaryotic cell is a bacterial cell.