Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the chimeric Cas9 protein to the target DNA.
2. The composition of claim 1 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
3. The composition of claim 1 , wherein the heterologous polypeptide has DNA-modifying activity.
4. The composition of claim 3 , wherein the DNA modifying activity is methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
5. The composition of claim 1 , wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein.
6. The composition of claim 1 , wherein the heterologous polypeptide is a protein tag.
7. The composition of claim 1 , wherein the heterologous polypeptide has protein-modifying activity.
8. The composition of claim 1 , comprising a protein-RNA complex comprising the chimeric Cas9 protein and the single molecule DNA-targeting RNA.
9. The composition of claim 1 , comprising the single molecule DNA-targeting RNA and the nucleic acid encoding the chimeric Cas9 protein.
10. The composition of claim 9 , wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
11. The composition of claim 1 , comprising the nucleic acid encoding the chimeric Cas9 protein and the nucleic acid encoding the single molecule DNA-targeting RNA.
12. The composition of c 13, wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
13. The composition of claim 11 , wherein the nucleic acid encoding the chimeric Cas9 protein and/or the nucleic acid encoding the single molecule DNA-targeting is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
14. The composition of claim 1 , wherein:
(1) the activator-RNA comprises the 67 nt tracrRNA sequence
(SEQ ID NO: 432)
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC
GAGUCGGUGCUUUUUUU;
or
(2) the activator RNA comprises the 26 nucleotide tracrRNA sequence
(SEQ ID NO: 397)
UAGCAAGUUAAAAUAAGGCUAGUCCG;
or
(3) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence
(SEQ ID NO: 432)
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC
GAGUCGGUGCUUUUUUU.
15. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
16. The composition of claim 15 , wherein the single molecule DNA-targeting RNA comprises the non-natural internucleoside linkage and the modified sugar moiety.
17. The composition of claim 16 , wherein the single molecule DNA-targeting RIA does not include a nucleic acid mimetic or a modified nucleobase.
18. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholine nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
19. The composition of claim 18 , wherein the single molecule DNA-targeting RNA comprises a 2′-O-methyl modified sugar moiety or a 2′-fluoro modified sugar moiety.
20. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.
21. A kit comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the arg er-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the chimeric Cas9 protein to the target DNA; and
wherein (a) and (b) are separated.
22. The kit of claim 21 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
23. The kit of claim 21 , wherein the heterologous polypeptide has DNA-modifying activity.
24. The kit of claim 23 , wherein the DNA modifying activity is methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
25. The kit of claim 21 , wherein the heterologous polypeptide has protein-modifying activity.
26. The kit of claim 21 , comprising the chimeric Cas9 protein and the single molecule DNA-targeting RNA.
27. The kit of claim 21 , comprising the nucleic acid encoding the chimeric Cas9 protein.
28. The kit of claim 27 , wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
29. The kit of claim 27 , wherein the nucleic acid encoding the chimeric Cas9 protein is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
30. The kit of claim 20 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.