Chemically modified RNA aptamers and uses thereof
Provided are chemically modified ribonucleic acid (RNA) aptamers comprising one or more of 2′F guanylate, 2′OMe cytidylate, 2′OMe adenylate, and a deoxy pyrimidine nucleotide with a moiety on the 5 position of the pyrimidine; and methods of making the aptamers.
1. A method for preparing a chemically modified ribonucleic acid (RNA) aptamer that binds to a target in a tissue or cell sample or surface or to a target protein or small molecule, the method comprising:
contacting a candidate mixture of RNAs with the tissue or cell sample, surface, protein or small molecule, wherein the mixture comprises 2′F guanylate, 2′OMe cytidylate, 2′OMe adenylate, and a deoxy pyrimidine nucleotide with a moiety on the 5 position of the pyrimidine, wherein the mixture of RNAs are transcribed from a DNA template having no thymine residues within a first 20 nucleotides of its transcript, and wherein RNAs having affinity to the target bind the target and form RNA-target complexes;
separating RNA-target complexes from free RNAs in the candidate mixture; and
identifying chemically modified RNAs that bind to the target in the tissue or cell sample, surface, protein or small molecule, thereby preparing a chemically modified RNA aptamer that binds to a target in a tissue or cell sample or surface or to a target protein or small molecule.
2. The method of claim 1 , wherein the aptamer is prepared using iterative rounds of selection against the target.
3. The method of claim 1 , wherein the candidate mixture of RNAs is contacted with the tissue or cell sample, surface, protein or small molecule, and with a T7 RNA polymerase having one or more of the following mutations: Y639L, H784A and P266L.
4. The method of claim 3 , wherein the T7 RNA polymerase is a LAL-polymerase comprising the following mutations: Y639L, H784A and P266L.
5. The method of claim 1 , wherein the mixture comprises a buffer comprising 40 mM Tris [pH 8.3], 40 mM dithiothreitol, 1 mM spermidine, 0.01% Triton X-100, 50 mg/ml PEG-8000, 25 mM MgCl 2 and 10 mM MnCl 2 .
6. The method of claim 1 , wherein the mixture comprises betaine.
7. The method of claim 6 , wherein betaine is present at a final concentration of at least 1 M.
8. The method of claim 6 , wherein betaine is present at a final concentration of 1-2.5 M.
9. The method of claim 1 , wherein the deoxy pyrimidine nucleotide with a moiety of the 5 position of the pyrimidine is a modified deoxyuridine, 2′OMe, 2′NH 2 , 2′H or locked nucleic acid residue.
10. The method of claim 1 , wherein the deoxy pyrimidine nucleotide with a moiety on the 5 position of the pyrimidine is Phe-dUTP, Bza-dUTP, isobutyl-dUTP, tyrosyl-dUTP, napthyl-dUTP, Phe-dCTP, Bza-dCTP, isobutyl-dCTP, tyrosyl-dCTP, or napthyl-dCTP.
11. The method of claim 1 , wherein the deoxy pyrimidine nucleotide with a moiety on the 5 position of the pyrimidine consists of a triphosphate of a structure selected from the following:
wherein R is
wherein z# represents the point of attachment of the R group to the pyrimidine or modified pyrimidine.
12. The method of claim 9 , wherein Phe-dUTP, Bza-dUTP, isobutyl-dUTP, tyrosyl-dUTP, Phe-dCTP, Bza-dCTP, Bza-dCTP, isobutyl-dCTP, tyrosyl-dCTP, or napthyl-dCTP or the 5’-modified deoxy pyrimidine nucleotide is present in a concentration of 1-2.5 mM.
13. The method of claim 9 , wherein Phe-dUTP, Bza-dUTP, isobutyl-dUTP, tyrosyl-dUTP, napthyl-dUTP, Phe-dCTP, Bza-dCTP, isobutyl-dCTP, tyrosyl-dCTP, or napthyl-dCTP or the 5′-modified deoxy pyrimidine nucleotide is present in a concentration of 2 mM.
14. The method of claim 1 , wherein the moiety on the 5 position of the pyrimidine is a hydrophobic moiety.
15. The method of claim 1 , wherein one or more of 2′F guanylate, 2′OMe cytidylate and 2′OMe adenylate is present in a concentration of 25 mM.
16. The method of claim 1 , wherein the aptamer comprises one or more of nucleotide sequence
(SEQ ID NO: 3)
GGGAAGGAGAGACGACGCGACACCCCCTTGAGTCACAGGTGTGTGAGCGC
CGACGGCTTGGTACAGCAGACAAGACCGGACAAGAAGC
and
(SEQ ID NO: 4)
GGGAAGGAGAGACGACGCGACACCCGCTTCACCGCTGTGTAACTGCGACG
ACGGACGTCAGATCAGCAGACAAGACCGGACAAGAAGC.
17. The method of claim 1 , wherein the aptamer comprises one or more of nucleotide sequence
(SEQ ID NO: 5)
GGGAAGGAGAGACGACGCGACACTCGAAAATGCTGGAGTAACTTCTTAGA
GTACTTGGC;
(SEQ ID NO: 6)
GGGAGAGACGACGCGACACTCGAAAATGCTGGAGTAACTTCTTAGAGTAC
TTGGC;
(SEQ ID NO: 7)
GGGCGACGCGACACTCGAAAATGCTGGAGTAACTTCTTAGAGTACTTGGC;
and
(SEQ ID NO: 8)
CGACGCGACACTCGAAAATGCTGGAGTAACTTCTTAGAGTACTTGGC.
18. A chemically modified ribonucleic acid (RNA) aptamer comprising one or more of 2′F guanylate, 2′OMe cytidylate, 2′OMe adenylate, and a modified deoxy pyrimidine nucleotide with a moiety on the 5 position of the pyrimidine, wherein the RNA aptamer has no uridine residues within the first 20 nucleotides.