IP Library Granted Patent US 10,526,619
Granted Patent B2
US 10,526,619 · App. 16/380,758 · Granted Jan 7, 2020

Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

Inventors: Jennifer A. Doudna (Berkeley, CA); Martin Jinek (Berkeley, CA); Krzysztof Chylinski (Vienna, AT); Emmanuelle Charpentier (Braunschweig, DE)
Assignees: The Regents of the University of California; University of Vienna; Emmanuelle Charpentier
C12N15/907A01H6/4684A01K67/027A61K38/465C12N9/22C12N15/102C12N15/111C12N15/113C12N15/63C12N15/70C12N15/746C12N15/90C12N15/902A61K48/00C12N2310/11C12N2310/13C12N2310/14C12N2310/20C12N2310/31C12N2310/32C12N2310/33C12N2310/3519C12N2310/531C12N2800/80C12Y301/04
View Patent ↗
Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US 10,526,619
App. No.
16/380,758
Granted
Jan 7, 2020
Kind
B2
Abstract

The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.

Claims (58)

1. A composition comprising

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a DNA-targeting RNA comprising:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

2. The composition of claim 1 , comprising a protein-RNA complex comprising the Cas9 protein and the DNA-targeting RNA.

3. The composition of claim 1 , comprising the nucleic acid encoding the Cas9 protein.

4. The composition of claim 1 , further comprising a donor polynucleotide.

5. The composition of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide.

6. The composition of claim 1 , wherein:

(1) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 432); or

(2) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).

7. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

8. The composition of claim 7 , wherein the DNA-targeting RNA comprises said modified sugar moiety and/or said non-natural internucleoside linkage.

9. A composition comprising

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a DNA-targeting RNA comprising:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.

10. The composition of claim 9 , comprising a protein-RNA complex comprising the Cas9 protein and the DNA-targeting RNA.

11. The composition of claim 9 , comprising the nucleic acid encoding the Cas9 protein.

12. The composition of claim 9 , further comprising a donor polynucleotide.

13. The composition of claim 9 , wherein the Cas9 protein is fused to a heterologous polypeptide.

14. The composition of claim 9 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain.

15. The composition of claim 9 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

16. The composition of claim 15 , wherein the DNA-targeting RNA comprises said modified sugar moiety and/or said non-natural internucleoside linkage.

17. A kit comprising

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a DNA-targeting RNA comprising:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA; and

wherein (a) and (b) are separated.

18. The kit of claim 17 , comprising the Cas9 protein.

19. The kit of claim 17 , comprising the nucleic acid encoding the Cas9 protein.

20. The kit of claim 17 , wherein the Cas9 protein is fused to a heterologous polypeptide.

21. The kit of claim 17 , further comprising a donor polynucleotide.

22. The kit of claim 17 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain.

23. The kit of claim 17 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

24. A kit comprising

(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and

(b) a DNA-targeting RNA comprising:

(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and

(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,

wherein (i) and (ii) are covalently linked,

wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA; and

wherein (a) and (b) are separated.

25. The kit of claim 24 , comprising the nucleic acid encoding the Cas9 protein.

26. The kit of claim 24 , wherein the Cas9 protein is fused to a heterologous polypeptide.

27. The kit of claim 24 , wherein the Cas9 protein comprises a mutation in a RuvC domain and an HNH domain.

28. The kit of claim 24 , further comprising a donor polynucleotide.

29. The kit of claim 24 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.

30. The kit of claim 29 , wherein the DNA-targeting RNA comprises said modified sugar moiety and/or said non-natural internucleoside linkage.

Assignments (2)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Apr 30, 2019
From: DOUDNA, JENNIFER A.; JINEK, MARTIN
To: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA
Reel/Frame 049038/0831 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Apr 30, 2019
From: CHYLINSKI, KRZYSZTOF
To: UNIVERSITY OF VIENNA
Reel/Frame 049038/0842 →
Continuity (6)
Continuation 13842859 · Mar 15, 2013
Provisional Application 61765576 · Feb 15, 2013
Provisional Application 61757640 · Jan 28, 2013
Provisional Application 61716256 · Oct 19, 2012
Provisional Application 61652086 · May 25, 2012
Related Publication 20190256869A1 · Aug 22, 2019
Cited By (2)
US 12,201,699 US 12,338,436