Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.
2. The composition of claim 1 , comprising a protein-RNA complex comprising the Cas9 protein and the DNA-targeting RNA.
3. The composition of claim 2 , further comprising a donor polynucleotide.
4. The composition of claim 1 , comprising the nucleic acid encoding the Cas9 protein.
5. The composition of claim 4 , wherein the nucleic acid encoding the Cas9 protein is an RNA.
6. The composition of claim 5 , further comprising a donor polynucleotide.
7. The composition of claim 4 , wherein the nucleic acid encoding the Cas9 protein is a DNA.
8. The composition of claim 7 , further comprising a donor polynucleotide.
9. The composition of claim 4 , wherein the nucleic acid encoding the Cas9 protein is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
10. The composition of claim 1 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432).
11. The composition of claim 1 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
12. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
13. The composition of claim 12 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
14. The composition of claim 12 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage.
15. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
16. The composition of claim 15 , wherein the DNA-targeting RNA comprises said 2′-O-methyl modified sugar moiety and/or said 2′-fluoro modified sugar moiety.
17. The composition of claim 1 , wherein the DNA-targeting RNA comprises a phosphorothioate internucleoside linkage.
18. A kit comprising
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain; and
(b) a DNA-targeting RNA comprising:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA; and
wherein (a) and (b) are separated.
19. The kit of claim 18 , comprising the Cas9 protein.
20. The kit of claim 18 , comprising the nucleic acid encoding the Cas9 protein.
21. The kit of claim 20 , wherein the nucleic acid encoding the Cas9 protein is a DNA.
22. The kit of claim 16 , wherein the DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
23. The kit of claim 22 , wherein the DNA-targeting RNA comprises said 2′-O-methyl modified sugar moiety and/or said 2′-fluoro modified sugar moiety.
24. The kit of claim 20 , wherein the nucleic acid encoding the Cas9 protein is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
25. The kit of claim 20 , wherein the nucleic acid encoding the Cas9 protein is an RNA.
26. The kit of claim 18 , further comprising a donor polynucleotide.
27. The kit of claim 18 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432).
28. The kit of claim 18 , wherein the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
29. The kit of claim 18 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
30. The kit of claim 29 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.