Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising a DNA-targeting RNA that comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.
2. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
3. The composition of claim 2 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
4. The composition of claim 2 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage.
5. The composition of claim 1 , wherein the DNA-targeting RNA comprises a phosphorothioate internucleoside linkage.
6. The composition of claim 1 , wherein the DNA-targeting RNA comprises a non-natural internucleoside linkage that comprises one or more of: a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, and a boranophosphate.
7. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: (i) a non-natural internucleoside linkage that is a phosphorothioate, an inverted polarity linkage, or an abasic nucleoside linkage; (ii) a locked nucleic acid (LNA); and (iii) a modified sugar moiety that is 2′-O-methoxyethyl, 2′-O-methyl, or 2′-fluoro.
8. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a peptide nucleic acid (PNA), a morpholino nucleic acid, a cyclohexenyl nucleic acid (CeNA), and a locked nucleic acid (LNA).
9. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a 2′-O-methyl modified sugar moiety, and a 2′-fluoro modified sugar moiety.
10. The composition of claim 1 , wherein the DNA-targeting RNA comprises one or more of: a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine; a pseudouracil; a 4-thiouracil; an 8-haloadenin; an 8-aminoadenin; an 8-thioladenin; an 8-thioalkyladenin; an 8-hydroxyladenin; an 8-haloguanin; an 8-aminoguanin; an 8-thiolguanin; an 8-thioalkylguanin; an 8-hydroxylguanin; a 5-halouracil; a 5-bromouracil; a 5-trifluoromethyluracil; a 5-halocytosine; a 5-bromocytosine; a 5-trifluoromethylcytosine, a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2-amino-adenine; an 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6 or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; and a 5-propynylcytosine.
11. The composition of claim 1 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432).
12. The composition of claim 1 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
13. The composition of claim 1 , wherein the composition is sterile.
14. The composition of claim 1 , comprising a nuclease inhibitor.
15. The composition of claim 1 , comprising a buffering agent.
16. The composition of claim 15 , wherein the buffering agent is a buffer for stabilizing nucleic acids.
17. The composition of claim 1 , comprising a pharmaceutically-acceptable, non-toxic carrier or diluent.
18. The composition of claim 1 , comprising one or more of: a detergent, a carbohydrate, a polyamine, an amino acid, a peptide, sodium, potassium, calcium, magnesium, manganese, and a lipid.
19. The composition of claim 1 , wherein the composition is lyophilized.
20. The composition of claim 1 , wherein the composition is a therapeutic formulation for administration to an animal or human.
21. The composition of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 15 nucleotides (nt) to 18 nt long.
22. The composition of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence of the target DNA is 18 nucleotides (nt) to 25 nt long.
23. The DNA-targeting RNA of claim 1 , wherein the DNA-targeting RNA comprises one or more non-naturally-occurring nucleotides.
24. The DNA-targeting RNA of claim 23 , wherein the one or more non-naturally-occurring nucleotides are modified at one or more of: a ribose, a phosphate, and a base moiety.
25. The DNA-targeting RNA of claim 23 , wherein said one or more non-naturally-occurring nucleotides comprises a 2′-O-methyl analog.
26. The DNA-targeting RNA of claim 23 , wherein said one or more non-naturally-occurring nucleotides comprises a 2′-fluoro analog.
27. A composition comprising a DNA-targeting RNA that comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a 15 nucleotide (nt) to 25 nt long target sequence of a target DNA, and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the Cas9 protein to the target DNA.
28. The composition of claim 27 , wherein the composition is lyophilized.
29. The composition of claim 27 , wherein the DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
30. The composition of claim 29 , wherein the DNA-targeting RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.