Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A method of making a modified cell, the method comprising:
introducing into a target cell comprising a target DNA:
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to and hybridizes with a target sequence of a target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA targets the chimeric Cas9 protein to the target sequence of the target DNA, and wherein said introducing results in modifying the target DNA, modulating transcription from the target DNA, and/or modifying a protein associated with the target DNA, thereby producing a modified cell.
2. The method of claim 1 , wherein the target DNA is chromosomal DNA.
3. The method of claim 1 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor.
4. The method of claim 1 , wherein the heterologous polypeptide has DNA-modifying activity or has protein-modifying activity.
5. The method of claim 1 , wherein the heterologous polypeptide has one or more of: methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, and glycosylase activity.
6. The method of claim 1 , wherein the heterologous polypeptide comprises one or more of: a 6×His tag, a hemagglutinin (HA) tag, and a green fluorescent protein.
7. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
8. The method of claim 7 , wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
9. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises a heterologous moiety.
10. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
11. The method of claim 1 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
12. The method of claim 1 , wherein the method further comprises introducing a donor polynucleotide into the target cell and a sequence of the donor polynucleotide is integrated into the target DNA.
13. A method of making a modified cell, the method comprising:
contacting a population of target cells with:
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a DNA-targeting RNA or a nucleic acid encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to and hybridizes with target sequence of a target DNA inside of one or more target cells of said population of target cells, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,
wherein (i) and (ii) are covalently linked, wherein the DNA-targeting RNA targets the chimeric Cas9 protein to the target sequence of the target DNA, and wherein said contacting results in modifying the target DNA, modulating transcription from the target DNA, and/or modifying a protein associated with the target DNA inside of one or more target cells of said population of target cells, thereby producing one or more modified cells.
14. The method of claim 13 , wherein the target DNA is chromosomal DNA.
15. The method of claim 13 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide and said contacting results in modulating transcription from the target DNA.
16. The method of claim 13 , wherein the heterologous polypeptide has DNA-modifying activity or has protein-modifying activity.
17. The method of claim 13 , wherein the heterologous polypeptide has one or more of: methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, and glycosylase activity.
18. The method of claim 13 , wherein the heterologous polypeptide comprises one or more of: a 6×His tag, a hemagglutinin (HA) tag, and a green fluorescent protein.
19. The method of claim 13 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
20. The method of claim 19 , wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
21. The method of claim 13 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
22. The method of claim 13 , wherein the activator-RNA and/or the targeter-RNA comprises one Or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
23. The method of claim 13 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
24. A method of making a modified cell, the method comprising:
introducing a composition comprising a protein-RNA complex into a target cell that comprises a target DNA, wherein the protein-RNA complex comprises:
(a) a chimeric Cas9 protein that comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide comprises one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a DNA-targeting RNA that comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to and hybridizes with a target sequence of a target DNA, and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex,
wherein (i) and (ii) are covalently linked,
wherein the DNA-targeting RNA targets the chimeric Cas9 protein to the target sequence of the target DNA, and wherein said introducing results in modifying the target DNA, modulating transcription from the target DNA, and/or modifying a protein associated with the target DNA, thereby producing a modified cell.
25. The method of claim 24 , wherein the target DNA is chromosomal DNA.
26. The method of claim 24 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
27. The method of claim 24 , wherein the heterologous polypeptide has DNA-modifying activity or has protein-modifying activity.
28. The method of claim 24 , wherein the heterologous polypeptide has methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
29. The method of claim 24 , wherein the heterologous polypeptide comprises one or more of: a 6×His tag, a hemagglutinin (HA) tag, and a green fluorescent protein.
30. The method of claim 24 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).