Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A method of making a genetically modified cell, comprising:
introducing into a target cell comprising a target DNA:
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and
(b) a double molecule DNA-targeting RNA or one or more nucleic acids encoding the double molecule DNA-targeting RNA, wherein the double molecule DNA-targeting RNA comprises:
(i) a targeter-RNA that comprises:
a first nucleotide sequence that is complementary to and hybridizes with a 15 to 25 nucleotide long target sequence of the target DNA, and
a second nucleotide sequence that hybridizes with an activator-RNA to form a double-stranded RNA duplex, wherein the first and second nucleotide sequences are heterologous to one another, and
(ii) the activator-RNA,
wherein the second nucleotide sequence of the targeter-RNA hybridizes with the activator-RNA to form a total of 8 to 15 base pairs,
wherein said introducing results in editing of the target DNA thereby producing the genetically modified cell.
2. The method of claim 1 , wherein the target DNA is chromosomal DNA.
3. The method of claim 1 , wherein the double molecule DNA-targeting RNA is introduced into the target cell by introducing the activator-RNA and the targeter-RNA into the target cell as RNAs.
4. The method of claim 1 , wherein the method further comprises introducing a donor polynucleotide into the target cell and a sequence of the donor polynucleotide is integrated into the target DNA.
5. The method of claim 1 , wherein the Cas9 protein is fused to a heterologous protein.
6. The method of claim 5 , wherein the heterologous protein has DNA modifying activity.
7. The method of claim 1 , wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.
8. The method of claim 1 , wherein the method comprises introducing into the cell two or more different targeter-RNAs that hybridize to different target sequences.
9. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
10. The method of claim 9 , wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
11. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
12. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises comprises a heterologous moiety.
13. The method of claim 1 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
14. The method of claim 1 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
15. The method of claim 1 , wherein the cell is a bacterial cell.
16. A method of making a genetically modified cell, comprising:
contacting a population of target cells with:
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein; and
(b) a double molecule DNA-targeting RNA or one or more nucleic acids encoding the double molecule DNA-targeting RNA, wherein the double molecule DNA-targeting RNA comprises:
(i) a targeter-RNA that comprises:
a first nucleotide sequence that is complementary to and hybridizes with a 15 to 25 nucleotide long target sequence of a target DNA inside of one or more target cells of said population of target cells, and
a second nucleotide sequence that hybridizes with an activator-RNA to form a double-stranded RNA duplex, wherein the first and second nucleotide sequences are heterologous to one another, and
(ii) the activator-RNA,
wherein the second nucleotide sequence of the targeter-RNA hybridizes with the activator-RNA to form a total of 8 to 15 base pairs,
wherein said contacting results in editing of the target DNA inside of one or more target cells of said population of target cells, thereby producing one or more genetically modified cells.
17. The method of claim 16 , wherein the method further comprises, after said contacting, culturing said one or more genetically modified cells to produce a population of cells.
18. The method of claim 16 , wherein the target DNA is chromosomal DNA.
19. The method of claim 16 , wherein the method further comprises contacting the population of target cells with a donor polynucleotide and a sequence of the donor polynucleotide is integrated into the target DNA inside of said one or more target cells of said population of target cells.
20. The method of claim 16 , wherein the Cas9 protein is fused to a heterologous protein.
21. The method of claim 20 , wherein the heterologous protein has DNA modifying activity.
22. The method of claim 16 , wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.
23. The method of claim 16 , wherein the method comprises contacting the population of target cells with two or more different targeter-RNAs that hybridize to different target sequences.
24. The method of claim 16 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
25. The method of claim 24 , wherein the activator-RNA and/or the targeter-RNA comprises said non-natural internucleoside linkage and/or said modified sugar moiety.
26. The method of claim 16 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-substituted sugar moiety, a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
27. The method of claim 16 , wherein the activator-RNA and/or the targeter-RNA comprises comprises a heterologous moiety.
28. The method of claim 16 , wherein the activator-RNA and/or the targeter-RNA comprises one or more of the following heterologous moieties: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioester; a thiocholesterol; a lipid; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a coumarin; and a dye.
29. The method of claim 16 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG CUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
30. The method of claim 16 , wherein the population of target cells is a population of bacterial cells.