RNA-guided human genome engineering
A method of altering a eukaryotic cell is provided including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner.
1. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides,
wherein the guide RNA has a secondary structure comprising a first hairpin connected to the spacer sequence and a second 3′ hairpin.
2. An ex vivo eukaryotic cell containing the RNA-guided genome editing system of claim 1 .
3. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
4. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a stem cell.
5. The eukaryotic cell of claim 2 wherein the eukaryotic cell is a human induced pluripotent stem cell.
6. The RNA-guided genome editing system of claim 1 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a regulatory element operable in a eukaryotic cell operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
7. The RNA-guided genome editing system of claim 1 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a human U6 polymerase III promoter operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
8. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid.
9. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a nuclear localization signal.
10. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal nuclear localization signal.
11. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal SV40 nuclear localization signal.
12. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
13. The RNA-guided genome editing system of claim 1 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.
14. The RNA-guided genome editing system of claim 1 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
15. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
16. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a stem cell.
17. The RNA-guided genome editing system of claim 1 wherein the eukaryotic cell is a human induced pluripotent stem cell.
18. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
19. The RNA-guided genome editing system of claim 18 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a regulatory element operable in a eukaryotic cell operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
20. The RNA-guided genome editing system of claim 18 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a human U6 polymerase III promoter operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
21. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid.
22. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a nuclear localization signal.
23. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal nuclear localization signal.
24. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal SV40 nuclear localization signal.
25. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
26. The RNA-guided genome editing system of claim 18 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.
27. The RNA-guided genome editing system of claim 18 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
28. The RNA-guided genome editing system of claim 18 wherein the eukaryotic cell is a stem cell.
29. The RNA-guided genome editing system of claim 18 wherein the eukaryotic cell is a human induced pluripotent stem cell.
30. An ex vivo eukaryotic cell containing the RNA-guided genome editing system of claim 18 .
31. The eukaryotic cell of claim 30 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
32. The eukaryotic cell of claim 30 wherein the eukaryotic cell is a stem cell.
33. The eukaryotic cell of claim 30 wherein the eukaryotic cell is a human induced pluripotent stem cell.
34. The RNA-guided genome editing system of claim 18 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
35. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).
36. The RNA-guided genome editing system of claim 35 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a regulatory element operable in a eukaryotic cell operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
37. The RNA-guided genome editing system of claim 35 comprising (1) the first nucleic acid sequence encoding the guide RNA sequence and further comprising a human U6 polymerase III promoter operably linked to the first nucleic acid sequence encoding the guide RNA sequence.
38. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid.
39. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a nuclear localization signal.
40. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal nuclear localization signal.
41. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid and encodes a C-terminal SV40 nuclear localization signal.
42. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a regulatory element operable in a eukaryotic cell.
43. The RNA-guided genome editing system of claim 35 comprising (2) the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system, wherein the second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system is a human codon optimized nucleic acid comprising a human U6 polymerase III promoter.
44. The RNA-guided genome editing system of claim 35 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
45. The RNA-guided genome editing system of claim 35 wherein the eukaryotic cell is a stem cell.
46. The RNA-guided genome editing system of claim 35 wherein the eukaryotic cell is a human induced pluripotent stem cell.
47. An ex vivo eukaryotic cell containing the RNA-guided genome editing system of claim 35 .
48. The eukaryotic cell of claim 47 wherein the eukaryotic cell is a yeast cell, a plant cell, a mammalian cell or a human cell.
49. The eukaryotic cell of claim 47 wherein the eukaryotic cell is a stem cell.
50. The eukaryotic cell of claim 47 wherein the eukaryotic cell is a human induced pluripotent stem cell.
51. The RNA-guided genome editing system of claim 35 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
52. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a human U6 polymerase III promoter operably linked to a first nucleic acid sequence encoding a guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides.
53. The RNA-guided genome editing system of claim 52 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
54. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a human codon optimized nucleic acid sequence encoding a Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides.
55. The RNA-guided genome editing system of claim 54 wherein the human codon optimized nucleic acid encoding the Cas enzyme of a Type II CRISPR system further encodes a nuclear localization signal.
56. The RNA-guided genome editing system of claim 55 wherein the nuclear localization signal is a C-terminal nuclear localization signal.
57. The RNA-guided genome editing system of claim 55 wherein the C-terminal nuclear localization signal is a C-terminal SV40 nuclear localization signal.
58. The RNA-guided genome editing system of claim 54 wherein the human codon optimized nucleic acid encoding the Cas enzyme comprises a regulatory element operable in a eukaryotic cell.
59. The RNA-guided genome editing system of claim 58 wherein the regulatory element is a human U6 polymerase III promoter.
60. The RNA-guided genome editing system of claim 54 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
61. An RNA-guided genome editing system for use in a eukaryotic cell comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides,
wherein the eukaryotic cell is a stem cell.
62. The RNA-guided genome editing system of claim 61 wherein the stem cell is a human induced pluripotent stem cell.
63. The RNA-guided genome editing system of claim 61 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
64. A ex vivo eukaryotic cell containing an RNA-guided genome editing system comprising
(1) a guide RNA sequence or a first nucleic acid sequence encoding the guide RNA sequence and
(2) a Cas enzyme of a Type II CRISPR system that forms a complex with the guide RNA sequence, or a second nucleic acid sequence encoding the Cas enzyme of a Type II CRISPR system,
wherein the guide RNA sequence comprises a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the guide RNA sequence is a crRNA-tracrRNA fusion transcript of between 100 and 250 nucleotides,
wherein the eukaryotic cell is a stem cell.
65. The ex vivo eukaryotic cell of claim 64 wherein the stem cell is a human induced pluripotent stem cell.
66. The ex vivo eukaryotic cell containing an RNA-guided genome editing system of claim 64 wherein the Cas enzyme of a Type II CRISPR system is Cas9.
67. A guide RNA for use in a eukaryotic cell comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:46).
68. A guide RNA for use in a eukaryotic cell comprising a spacer sequence complementary to a target nucleic acid sequence within the eukaryotic cell and a scaffold sequence, and wherein the scaffold sequence comprises GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA AAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:45).