Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use
RNAi agents for inhibiting the expression of the alpha-1 antitrypsin (AAT) gene, compositions including AAT RNAi agents, and methods of use are described. Also disclosed are pharmaceutical compositions including one or more AAT RNAi agents together with one or more excipients capable of delivering the RNAi agent(s) to a liver cell in vivo. Delivery of the AAT RNAi agent(s) to liver cells in vivo inhibits AAT gene expression and treats diseases associated with AAT deficiency such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure.
1. A method for reducing the protein level of Alpha-1 Antitrypsin (AAT) in a subject in need thereof, comprising administering to the subject a pharmaceutically acceptable amount of a composition comprising an RNAi agent, wherein the RNAi agent comprises a sense strand and an antisense strand, wherein nucleotides 2-18 of the antisense strand comprise nucleotides 2-18 of NGUUAAACAUGCCUAAACN (SEQ ID NO:83), and wherein the sense strand is at least substantially complementary to the antisense strand, and wherein the antisense strand comprises (i) 2 or 3 phosphorothioate linkages at its 5′ end, (ii) 1 or 2 phosphorothioate linkages at its 3′ end, (iii) at least 8 nucleotides selected from 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, (iv) at least 11 nucleotides selected from 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, or (v) any combination thereof.
2. The method of claim 1 , wherein the RNAi agent comprises an antisense strand that comprises a nucleotide sequence selected from the group consisting of (5′→3′):
(i) UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794);
(ii) UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839);
(iii) UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800); and
(iv) UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801).
3. The method of claim 1 , wherein the RNAi comprises a sense strand that comprises a nucleotide sequence selected from the group consisting of (5′→3′):
(i) AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866);
(ii) CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857);
(iii) GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885); and,
(iv) CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864).
4. The method of claim 1 , wherein the RNAi agent comprises a targeting group.
5. The method of claim 4 , wherein the targeting group comprises an asialoglycoprotein receptor ligand.
6. The method of claim 5 , wherein the asialoglycoprotein receptor ligand comprises an N-acetylgalactosamine trimer.
7. The method of claim 1 , wherein the RNAi agent comprises at least one modified nucleotide and further comprises one or more targeting groups, wherein the targeting group has a structure selected from the group consisting of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), and (NAG39)s.
8. The method of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and s is a phosphorothioate linkage.
9. The method of claim 8 , wherein the sense strand comprises the sequence (5′→3′) agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine.
10. The method of claim 9 , wherein the RNAi agent has the duplex structure of AD04837 (SEQ ID PAIR NOs: 960/1033).
11. The method of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and s is a phosphorothioate linkage.
12. The method of claim 11 , wherein the sense strand comprises the sequence (5′→3′) cguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1276), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine.
13. The method of claim 12 , wherein the RNAi agent has the duplex structure of AD04828 (SEQ ID PAIR NOs: 913/1028).
14. The method of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and s is a phosphorothioate linkage.
15. The method of claim 14 , wherein the sense strand comprises the sequence (5′→3′) gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine.
16. The method of claim 15 , wherein the RNAi agent has the duplex structure of AD04831 (SEQ ID PAIR NOs: 958/1030).
17. The method of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and s is a phosphorothioate linkage.
18. The method of claim 17 , wherein the sense strand comprises the sequence (5′→3′) cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, or 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that includes N-acetyl-galactosamine.
19. The method of claim 18 , wherein the RNAi agent has the duplex structure of AD04836 (SEQ ID PAIR NOs: 959/1024).
20. The method of claim 1 , wherein the antisense strand is 21 or 22 nucleotides in length.
21. The method of claim 1 , wherein the antisense strand is fully modified.
22. The method of claim 1 , wherein the subject has the homozygous PiZZ genotype, or heterozygous PiZ/+ genotype.
23. The method of claim 1 , wherein the method reduces the protein level of AAT in a liver cell of the subject.
24. The method of claim 23 , wherein the liver cell is a hepatocyte.
25. The method of claim 1 , wherein the subject has a disease selected from the group consisting of chronic hepatitis, cirrhosis, hepatocellular carcinoma, transaminitis, cholestasis, fibrosis, and fulminant hepatic failure.