IP Library Patent Application 16596118
Patent Application
App. No. 16/596,118

NUCLEIC ACIDS AND METHODS FOR DETECTING CHROMOSOMAL ABNORMALITIES

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
16/596,118
Abstract

Methods and nucleic acid molecules for detecting chromosomal abnormalities such as aneuploidy. Methods for selecting nucleic acid molecules for use in the methods of the disclosure.

Claims (327)

1 . A method of detecting aneuploidy in a fetus comprising:

a) obtaining a nucleic acid sample isolated from a maternal blood sample;

b) capturing a plurality of target sequences of interest in the nucleic acid sample obtained in step a) by using one or more populations of molecular inversion probes (MIPs) to produce a plurality of replicons,

wherein each of the MIPs in the population of MIPs comprises in sequence the following components:

first targeting polynucleotide arm—first unique molecular tag—polynucleotide linker—second unique molecular tag—second targeting polynucleotide arm;

wherein the pair of first and second targeting polynucleotide arms in each of the MIPs are identical, and are substantially complementary to first and second regions in the nucleic acid that, respectively, flank each sequence in the plurality of target sequences of interest;

wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;

c) sequencing a plurality of MIPs amplicons that are amplified from the replicons obtained in step b);

d) determining the number of capture events of each of a first population of amplicons of the plurality of amplicons provided in step c) based on the number of the unique molecular tags of each MIP that amplified a replicon, wherein the first population of amplicons is determined by the sequence of the target sequence of interest;

e) determining the number of capture events of each of a second population of amplicons of the plurality of amplicons provided in step c) based on the number of the unique molecular tags of each MIP that amplified a replicon, wherein the second population of amplicons is determined by the sequence of the target sequence of interest;

f) determining, for each target sequence of interest from which the first population of amplicons was produced, a site capture metric based at least in part on the number of capture events determined in step d);

g) identifying a first subset of the site capture metrics determined in step f) that satisfy at least one criterion;

h) determining, for each target sequence of interest from which the second population of amplicons was produced, a site capture metric based at least in part on the number of capture events determined in step e);

i) identifying a second subset of the site capture metrics determined in step h) that satisfy the at least one criterion;

j) normalizing a first measure determined from the first subset of site capture metrics identified in step g) by a second measure determined from the second subset of site capture metrics identified in step i) to obtain a test ratio;

k) comparing the test ratio to a plurality of reference ratios that are computed based on reference nucleic acid samples isolated from reference subjects known to exhibit euploidy or aneuploidy; and

l) determining, based on the comparing in step k), whether aneuploidy is detected in the fetus.

2 . The method of claim 1 , wherein the nucleic acid sample is DNA or RNA.

3 . The method of claim 2 , wherein the nucleic acid sample is genomic DNA.

4 . The method of any one of claims 1 - 3 , wherein the blood sample is a whole blood sample, a plasma sample, or a serum sample.

5 . The method of claim 4 , wherein the blood sample is a plasma sample.

6 . The method of any one of claims 1 - 5 , wherein the length of the first targeting polynucleotide arm is between 14 and 30 base pairs.

7 . The method of any one of claims 1 - 6 , wherein the length of the second targeting polynucleotide arm is between 14 and 30 base pairs.

8 . The method of any one of claims 1 - 7 , wherein each of the targeting polynucleotide arms has a melting temperature between 45° C. and 80° C.

9 . The method of any one of claims 1 - 8 , wherein each of the targeting polynucleotide arms has a GC content between 30% and 80%, or between 30% and 70%.

10 . The method of any one of claims 1 - 9 , wherein the length of the first unique molecular tag is between 4 and 15 base pairs.

11 . The method of any one of claims 1 - 10 , wherein the length of the second unique molecular tag is between 4 and 15 base pairs.

12 . The method of any one of claims 1 - 11 , wherein each of the unique molecular tags has a melting temperature between 45° C. and 80° C.

13 . The method of any one of claims 1 - 12 , wherein each of the unique molecular tags have a GC content between 30% and 80%, or between 30% and 70%.

14 . The method of any one of claims 1 - 13 , wherein the polynucleotide linker is not substantially complementary to any genomic region of the subject.

15 . The method of any one of claims 1 - 14 , wherein the polynucleotide linker has a length of between 14 and 30 base pairs.

16 . The method of any one of claims 1 - 15 , wherein the polynucleotide linker has a melting temperature of between 45° C. and 80° C.

17 . The method of any one of claims 1 - 16 , wherein the polynucleotide linker has a GC content between 30% and 80%, or between 30% and 70%.

18 . The method of any one of claims 1 - 17 , wherein the polynucleotide linker comprises at least one amplification primer.

19 . The method of claim 18 , wherein the polynucleotide linker comprises a forward amplification primer and a reverse amplification primer.

20 . The method of claim 19 , wherein the sequence of the forward amplification primer comprises the nucleotide sequence of

(SEQ ID NO: 1)

5′-CTTCAGCTTCCCGATTACGG-3′.

21 . The method of claim 19 , wherein the sequence of the reverse amplification primer comprises the nucleotide sequence of

(SEQ ID NO: 2)

5′-GCACGATCCGACGGTAGTGT-3′.

22 . The method of any one of claims 1 - 21 , wherein the polynucleotide linker comprises the nucleotide sequence of

(SEQ ID NO: 3)

5′-CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT-3′.

23 . The method of any one of claims 1 - 22 , wherein the first targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 4)

5′-CACTGCACTCCAGCCTGG-3′.

24 . The method of any one of claims 1 - 23 , wherein the second targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 5)

5′-GAGGCTGAGGCAGGAGAA-3′.

25 . The method of any one of claims 1 - 24 , wherein the MIP comprises the nucleotide sequence of 5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′ (SEQ ID NO: 6), wherein (N 1-6 ) represents the first unique molecular tag and (N 7-12 ) represents the second unique molecular tag.

26 . The method of any one of claims 1 - 24 , wherein the MIP comprises the nucleotide sequence of any one of MIP 001-008 (SEQ ID NO: 7-14).

27 . The method of any one of claims 1 - 26 , wherein the population of MIPs has a concentration between 10 fM and 100 nM.

28 . The method of any one of claims 1 - 27 , wherein each of the MIPs replicons is a single-stranded circular nucleic acid molecule.

29 . The method of any one of claims 1 - 28 , wherein the site capture metric is a site capture efficiency index (SCE).

30 . The method of any one of claims 1 - 29 , wherein the site capture metric is a site capture consistency measure (SCC).

31 . The method of any one of claims 1 - 30 , wherein each of the MIPs replicons provided in step b) is produced by:

iii) the first and second targeting polynucleotide arms, respectively, hybridizing to the first and second regions in the nucleic acid sample, respectively, wherein the first and second regions flank a target sequence of interest; and

iv) after the hybridization, using a ligation/extension mixture to extend and ligate the gap region between the two targeting polynucleotide arms to form single-stranded circular nucleic acid molecules.

32 . The method of any one of claims 1 - 31 , wherein each of the MIPs replicons is a single-stranded circular nucleic acid molecule.

33 . The method of any one of claims 1 - 32 , wherein the sequencing step of c) comprises a next generation sequencing method.

34 . The method of claim 33 , wherein the next generation sequencing method comprises a massive parallel sequencing method, or a massive parallel short-read sequencing method.

35 . The method of any one of claims 1 - 34 , wherein the method comprises, before the sequencing step of c), a PCR reaction to amplify the MIPs replicons for sequencing.

36 . The method of claim 35 , wherein the PCR reaction is an indexing PCR reaction.

37 . The method of claim 36 , wherein the indexing PCR reaction introduces into each of the MIPs amplicons the following components: a pair of indexing primers, a unique sample barcode and a pair of sequencing adaptors.

38 . The method of claim 37 , wherein the barcoded MIPs amplicons comprise in sequence the following components:

a first sequencing adaptor—a first sequencing primer—the first unique targeting molecular tag—the first targeting polynucleotide arm—captured nucleic acid—the second targeting polynucleotide arm—the second unique targeting molecular tag—a unique sample barcode—a second sequencing primer—a second sequencing adaptor.

39 . The method of any one of claims 1 - 38 , wherein the first plurality of target sequences of interest is on a single chromosome.

40 . The method of any one of claims 1 - 39 , wherein the second plurality of target sequences of interest are on multiple chromosomes.

41 . The method of any one of claims 1 - 40 , wherein the site capture metric determined at step f) is the number of capture events determined at step d), and the site capture metric determined at step h) is the number of capture events determined at step e).

42 . The method of any one of claims 1 - 41 , further comprising computing a variability coefficient for a plurality of site capture metrics for a particular site, wherein each site capture metric in the plurality of site capture metrics is evaluated from a nucleic acid sample from a different subject, and wherein the at least one criterion used at steps g) and h) includes a requirement that the variability coefficient for the particular site is below a threshold value.

43 . The method of any one of claims 1 - 42 , wherein the first measure determined at step j) is a sum of the first subset of site capture metric and corresponds to a chromosome of interest, and the second measure determined at step j) is a sum of the second subset of site capture metric and corresponds to chromosomes other than the chromosome of interest.

44 . The method of any one of claims 1 - 43 , wherein the determining at step l) comprises performing a statistical test to evaluate whether the test ratio obtained at step j) is statistically different from the plurality of reference ratios.

45 . The method of any one of claims 1 - 44 , wherein the first population of amplicons corresponds to a chromosome of interest.

46 . The method of claim 45 , wherein the second population of amplicons corresponds to chromosomes other than the chromosome of interest.

47 . The method of any one of claims 1 - 46 , wherein the test ratio and the reference ratios are chromosomal fractions.

48 . The method of claim 47 , wherein the chromosomal fractions are defined by a ratio between a sum of all unique capture events from a chromosome of interest (S1) and a sum of all unique capture events from all chromosomes (S1+S2).

49 . The method of any one of claims 1 - 48 , wherein the size of the MIP replicon is between 80-90 base pairs.

50 . The method of any one of claims 1 - 49 , wherein the sequencing step has a read depth of between 6-8 million reads.

51 . The method of any one of claims 1 - 50 , wherein the target sequence of interest is located in an Alu element.

52 . The method of claim 51 , wherein the target sequence of interest is located in the right arm of an Alu element.

53 . The method of any one of claims 1 - 52 , wherein the aneuploidy is an autosomal aneuploidy, and the numbers of capture events determined in steps d) and e) exclude any capture events from sex chromosomes.

54 . The method of any one of claims 1 - 52 , wherein the aneuploidy is a sex chromosome aneuploidy, and the numbers of capture events determined in steps d) and e) include capture events from at least one sex chromosome.

55 . A method of detecting aneuploidy in a fetus comprising:

a) obtaining a genomic DNA sample from a maternal blood sample;

b) adding the genomic DNA sample into each well of a multi-well plate, wherein each well of the multi-well plate comprises a probe mixture, wherein the probe mixture comprises a population of molecular inversion probes (MIPs) and a buffer;

wherein each MIP in the population of MIPs comprises in sequence the following components:

first targeting polynucleotide arm—first unique molecular tag—polynucleotide linker—second unique molecular tag—second targeting polynucleotide arm;

wherein the pair of first and second targeting polynucleotide arms in each of the MIPs are identical, and are substantially complementary to first and second regions in the nucleic acid that, respectively, flank each sequence in a plurality of target sequences of interest;

wherein the first and second unique targeting molecular tags in each of the MIPs in combination are distinct in each of the MIPs;

c) incubating the genomic DNA sample with the probe mixture for the MIPs to capture the plurality of target sequences of interest;

d) adding an extension/ligation mixture to the sample of c) for the MIPs and the plurality of target sequences of interest to form a plurality of MIPs amplicons, wherein the extension/ligation mixture comprises a polymerase, a plurality of dNTPs, a ligase, and buffer;

e) adding an exonuclease mixture to the targeting and control MIPs amplicons to remove excess probes or excess genomic DNA;

f) adding an indexing PCR mixture to the sample of e) to add a pair of indexing primers, a unique sample barcode and a pair of sequencing adaptors to the plurality of amplicons;

g) using a massively parallel sequencing method to determine the number of sequencing reads of a first population of barcoded amplicons provided in step f) based on the number of the unique targeting molecular tags, wherein the first population of barcoded amplicons is identified by the sequence of the target sequence of interest;

h) using a massively parallel sequencing method to determine the number of sequencing reads of a second population of barcoded amplicons provided in step f) based on the number of the unique targeting molecular tags, wherein the second population of barcoded amplicons is identified by the sequence of the target sequence of interest;

i) computing a site capture metric based at least in part on the number of first sequencing reads determined in step g) and a plurality of control probe capture metrics based at least in part on the numbers of second sequencing reads determined in step h);

j) identifying a subset of site capture metrics of the population of the MIPs amplicons that have control probe capture metrics satisfying at least one criterion;

k) normalizing the site capture metric by a factor computed from the subset of control probe capture metrics satisfying the at least one criterion, to obtain a test normalized site capture metric;

l) comparing the test normalized site capture metric to a plurality of reference normalized site capture metrics that are computed based on reference genomic DNA samples obtained from reference subjects exhibiting known genotypes using the same target and control sites, target population, subset of control populations in steps b)-h); and

m) determining, based on the comparing in step 1 ) and the known genotypes of reference subjects, whether aneuploidy is detected in the fetus.

56 . The method of claim 55 , wherein the blood sample is a whole blood sample, a plasma sample, or a serum sample.

57 . The method of claim 56 , wherein the blood sample is a plasma sample.

58 . The method of any one of claims 55 - 57 , wherein the length of the first targeting polynucleotide arm is between 14 and 30 base pairs.

59 . The method of any one of claims 55 - 58 , wherein the length of the second targeting polynucleotide arm is between 14 and 30 base pairs.

60 . The method of any one of claims 55 - 59 , wherein each of the targeting polynucleotide arms has a melting temperature between 45° C. and 80° C.

61 . The method of any one of claims 55 - 60 , wherein each of the targeting polynucleotide arms has a GC content between 30% and 80%, or between 30% and 70%.

62 . The method of any one of claims 55 - 61 , wherein the length of the first unique molecular tag is between 4 and 15 base pairs.

63 . The method of any one of claims 55 - 62 , wherein the length of the second unique molecular tag is between 4 and 15 base pairs.

64 . The method of any one of claims 55 - 63 , wherein each of the unique molecular tags has a melting temperature between 45° C. and 80° C.

65 . The method of any one of claims 55 - 64 , wherein each of the unique molecular tags have a GC content between 30% and 80%, or between 30% and 70%.

66 . The method of any one of claims 55 - 65 , wherein the polynucleotide linker is not substantially complementary to any genomic region of the subject.

67 . The method of any one of claims 55 - 66 , wherein the polynucleotide linker has a length of between 20 and 1,000 base pairs.

68 . The method of any one of claims 55 - 67 , wherein the polynucleotide linker has a melting temperature of between 45° C. and 80° C.

69 . The method of any one of claims 55 - 68 , wherein the polynucleotide linker has a GC content between 30% and 80%, or between 30% and 70%.

70 . The method of any one of claims 55 - 69 , wherein the polynucleotide linker comprises at least one amplification primer.

71 . The method of claim 70 , wherein the polynucleotide linker comprises a forward amplification primer and a reverse amplification primer.

72 . The method of claim 71 , wherein the sequence of the forward amplification primer comprises the nucleotide sequence of

(SEQ ID NO: 1)

5′-CTTCAGCTTCCCGATTACGG-3′.

73 . The method of claim 72 , wherein the sequence of the reverse amplification primer comprises the nucleotide sequence of

(SEQ ID NO: 2)

5′-GCACGATCCGACGGTAGTGT-3′.

74 . The method of any one of claims 55 - 73 , wherein the polynucleotide linker comprises the nucleotide sequence of

(SEQ ID NO: 3)

5′-CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT-3′.

75 . The method of any one of claims 55 - 74 , wherein the first targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 4)

5′-CACTGCACTCCAGCCTGG-3′.

76 . The method of any one of claims 55 - 75 , wherein the second targeting polynucleotide arm comprises the nucleotide sequence of

(SEQ ID NO: 5)

5′-GAGGCTGAGGCAGGAGAA-3′.

77 . The method of any one of claims 55 - 76 , wherein the MIP comprises the nucleotide sequence of 5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′ (SEQ ID NO: 6), wherein (N 1-6 ) represents the first unique molecular tag and (N 7-12 ) represents the second unique molecular tag.

78 . The method of any one of claims 55 - 77 , wherein the population of MIPs has a concentration between 10 fM and 100 nM.

79 . The method of any one of claims 55 - 78 , wherein the size of the MIP replicon is between 80-90 base pairs.

80 . The method of any one of claims 55 - 79 , wherein the sequencing step has a read depth of between 6-8 million reads.

81 . A method of selecting a molecular inversion probe (MIP) from a plurality of candidate MIPs for using to detect aneuploidy in a subject, the method comprising:

a) receiving nucleic acid sequences of the plurality of candidate MIPs;

b) for each respective MIP in the plurality of candidate MIPs,

i) computing a first number (A) of unique sites predicted, with no mismatch, to be captured by the respective MIP on a chromosome of interest;

ii) computing a second number (C) of unique sites predicted, with one mismatch, to be captured by the respective MIP on the chromosome of interest;

iii) computing a third number (E) of unique sites predicted, with no mismatch, to be captured by the respective MIP across a genome;

iv) computing a fourth number (G) of unique sites predicted, with one mismatch, to be captured by the respective MIP across the genome;

v) computing a fifth number (F) of non-unique sites predicted, with no mismatch, to be captured by the respective MIP across the genome;

vi) computing a sixth number (H) of non-unique sites predicted, with one mismatch, to be captured by the respective MIP across the genome;

vii) computing a performance metric for the respective MIP based at least in part on the first, second, third, fourth, fifth, and sixth numbers;

c) selecting a MIP, based at least in part on the performance metric computed in step b)vii) for each MIP in the plurality of candidate MIPs.

82 . The method of claim 81 , wherein a unique site corresponds to a site that is captured by the respective MIP only once.

83 . The method of any of claims 81 - 82 , wherein a non-unique site corresponds to a site that is captured by the respective MIP more than once.

84 . The method of claim 83 , wherein the non-unique site is captured by the respective MIP more than once on the same chromosome, on different chromosomes, or both.

85 . The method of any of claims 81 - 84 , wherein the genome includes all autosomes, the X chromosome, and the Y chromosome.

86 . The method of any of claims 81 - 85 , wherein the MIP at step c) is selected such that a first ratio between the first number (A) and the fifth number (F) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

87 . The method of any of claims 81 - 86 , wherein the MIP at step c) is selected such that a second ratio between the first number (A) and the third number (E) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

88 . The method of any of claims 81 - 87 , wherein the MIP at step c) is selected such that a third ratio between the first number (A) and the second number (C) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

89 . The method of any of claims 81 - 88 , wherein the MIP at step c) is selected such that a fourth ratio between a first sum of the first number (A) and the second number (C) and a second sum of the third, fourth, fifth, and six numbers (E, F, G, H) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

90 . The method of any of claims 81 - 89 , wherein the MIP at step c) is selected such that a fifth ratio between a first weighted sum of the first number (A) and the second number (C) and a second weighted sum of the third, fourth, fifth, and six numbers (E, F, G, H) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

91 . The method of any of claims 81 - 90 , wherein the fifth ratio (P1) between the first weighted sum and the second weighted sum is:

P

1

=

A

+

K

e

C

(

E

+

F

)

+

K

e

(

G

+

H

)

.

92 . The method of any of claims 81 - 91 , wherein the fifth ratio (P) between the first weighted sum and the second weighted sum is:

P

=

(

A

+

K

e

C

)

2

(

E

+

F

)

+

K

e

(

G

+

H

)

.

93 . The method of any of claims 81 - 92 , wherein selecting the MIP at step c) includes comparing the performance metric to a predetermined threshold.

94 . The method of claim 93 , wherein the MIP that is selected at step c) has a fifth ratio (P) that exceeds 6.

95 . The method of any of claims 81 - 94 , wherein the MIP at step c) is selected such that a third weighted sum between the first number (A) and the second number (C) is larger than an equivalently weighted sum for a remaining set of the candidate MIPs.

96 . The method of claims 81 - 95 , wherein the third weighted sum is:

P 2= A+K e C

97 . The method of any of claims 81 - 96 , wherein the MIP at step c) is selected such that a product between the fifth ratio (P1) and the third weighted sum (P2) is larger than an equivalent product for a remaining set of the candidate MIPs.

98 . The method of any of claims 81 - 97 , wherein the performance metric is calculated based on a total number of useful reads from the chromosome of interest.

99 . The method of any of claims 81 - 98 , wherein the MIP at step c) is selected based on a ratio (K e ) of an average capture coefficient of one mismatch sites (K 1 ) and an average capture coefficient of zero mismatch sites (K 0 ):

K

e

=

K

1

K

0

and wherein the ratio (K e ) is experimentally estimated.

100 . The method of any of claims 81 - 99 , wherein the MIP at step c) is selected based on a total molecular tag count (TMTC) defined as:

TMTC= K 0 ( E+F )+ K 1 ( G+H )

101 . A method of selecting a molecular inversion probe (MIP) from a plurality of candidate MIPs for using to detect aneuploidy in a subject, the method comprising:

a) receiving nucleic acid sequences of the plurality of candidate MIPs;

b) for each respective MIP in the plurality of candidate MIPs,

i) computing a first number (A) of unique sites predicted, with no mismatch, to be captured by the respective MIP on a chromosome of interest;

ii) computing a second number (C) of unique sites predicted, with one mismatch, to be captured by the respective MIP on the chromosome of interest;

iii) computing a performance metric for the respective MIP based at least in part on the first and second numbers;

c) selecting a MIP, based at least in part on the performance metric computed in step b)iii) for each MIP in the plurality of candidate MIPs.

102 . The method of claim 101 , wherein a unique site corresponds to a site that is captured by the respective MIP only once.

103 . The method of any of claims 101 - 102 , wherein a non-unique site corresponds to a site that is captured by the respective MIP more than once.

104 . The method of claim 103 , wherein the non-unique site is captured by the respective MIP more than once on the same chromosome, on different chromosomes, or both.

105 . The method of any of claims 101 - 104 , wherein the MIP at step c) is selected such that a first ratio between the first number (A) and the second number (C) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

106 . A method of selecting a molecular inversion probe (MIP) from a plurality of candidate MIPs for using to detect aneuploidy in a subject, the method comprising:

a) receiving nucleic acid sequences of the plurality of candidate MIPs;

b) for each respective MIP in the plurality of candidate MIPs,

i) computing a first number (A) of unique sites predicted, with no mismatch, to be captured by the respective MIP on a chromosome of interest;

ii) computing a second number (F) of non-unique sites predicted, with no mismatch, to be captured by the respective MIP across the genome;

iii) computing a performance metric for the respective MIP based at least in part on the first and second numbers;

c) selecting a MIP, based at least in part on the performance metric computed in step b)iii) for each MIP in the plurality of candidate MIPs.

107 . The method of claim 106 , wherein a unique site corresponds to a site that is captured by the respective MIP only once.

108 . The method of any of claims 106 - 107 , wherein a non-unique site corresponds to a site that is captured by the respective MIP more than once.

109 . The method of claim 108 , wherein the non-unique site is captured by the respective MIP more than once on the same chromosome, on different chromosomes, or both.

110 . The method of any of claims 106 - 109 , wherein the MIP at step c) is selected such that a first ratio between the first number (A) and the second number (F) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

111 . The method of any of claims 106 - 110 , wherein the genome includes all autosomes, the X chromosome, and the Y chromosome.

112 . A method of selecting a molecular inversion probe (MIP) from a plurality of candidate MIPs for using to detect aneuploidy in a subject, the method comprising:

a) receiving nucleic acid sequences of the plurality of candidate MIPs;

b) for each respective MIP in the plurality of candidate MIPs,

i) computing a first number (A) of unique sites predicted, with no mismatch, to be captured by the respective MIP on a chromosome of interest;

ii) computing a second number (E) of unique sites predicted, with no mismatch, to be captured by the respective MIP across a genome;

iii) computing a performance metric for the respective MIP based at least in part on the first and second numbers;

c) selecting a MIP, based at least in part on the performance metric computed in step b)iii) for each MIP in the plurality of candidate MIPs.

113 . The method of claim 112 , wherein a unique site corresponds to a site that is captured by the respective MIP only once.

114 . The method of any of claims 112 - 113 , wherein a non-unique site corresponds to a site that is captured by the respective MIP more than once.

115 . The method of claim 114 , wherein the non-unique site is captured by the respective MIP more than once on the same chromosome, on different chromosomes, or both.

116 . The method of any of claims 112 - 115 , wherein the MIP at step c) is selected such that a first ratio between the first number (A) and the second number (E) is larger than an equivalent ratio for a remaining set of the candidate MIPs.

117 . The method of any of claims 112 - 116 , wherein the genome includes all autosomes, the X chromosome, and the Y chromosome.

118 . A nucleic acid molecule comprising a nucleotide sequence of 5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′ (SEQ ID NO: 6), wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

119 . The nucleic acid of claim 118 , wherein the length of the first unique molecular tag is between 4 and 15 base pairs.

120 . The nucleic acid of any one of claims 118 - 119 , wherein the length of the second unique molecular tag is between 4 and 15 base pairs.

121 . The nucleic acid of any one of claims 118 - 120 , wherein each of the unique targeting molecular tags has a melting temperature between 45° C. and 80° C.

122 . The nucleic acid of any one of claims 118 - 121 , wherein each of the unique targeting molecular tags have a GC content between 30% and 80% or between 30% and 70%.

123 . A nucleic acid molecule comprising a nucleotide sequence of

5′-A-(N)x-B-(N)y-C-3′,

wherein (N)x represents a first unique molecular tag and (N)y represents a second unique molecular tag, and wherein X and Y are between 4 and 15 base pairs,

wherein A i) comprises the sequence of 5′-TGCACTCCAGCCTG-3′ (SEQ ID NO: 15), or a sequence that is at least 85% similar to the sequence of 5′-TGCACTCCAGCCTG-3′ (SEQ ID NO: 15); and ii) has a length of no more than 30 base pairs,

wherein C i) comprises the sequence of 5′-GAGGCTGAGGCAGGA-3′(SEQ ID NO: 16), or a sequence that is at least 85% similar to the sequence of 5′-GAGGCTGAGGCAGGA-3′(SEQ ID NO: 16); and ii) has a length of no more than 30 base pairs.

124 . A nucleic acid molecule comprising a nucleotide sequence of

5′-A-(N)x-B-(N)y-C-3′,

wherein (N)x represents a first unique molecular tag and (N)y represents a second unique molecular tag, and wherein X and Y are between 4 and 15 base pairs,

wherein A i) comprises the sequence of 5′-TCCTGCCTCAGCCTC-3′ (SEQ ID NO: 17), or a sequence that is at least 85% similar to the sequence of 5′-TCCTGCCTCAGCCTC-3′(SEQ ID NO: 17); and ii) has a length of no more than 30 base pairs, and

wherein C i) comprises the sequence of 5′-AGGCTGGAGTGC-3′ (SEQ ID NO: 18), or a sequence that is at least 85% similar to the sequence of 5′-AGGCTGGAGTGC-3′(SEQ ID NO: 18); and ii) has a length of no more than 30 base pairs.

125 . The nucleic acid molecule of claim 123 or 124 , wherein B comprises the sequence of 5′-CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT-3′(SEQ ID NO: 3), or a sequence that is at least 85% similar to the sequence of 5′-CTTCAGCTTCCCGATTACGGGCACGATCCGACGGTAGTGT-3′(SEQ ID NO: 3).

126 . The nucleotide acid molecule of any one of claims 123 - 125 , wherein A or C has a melting temperature between 45° C. and 80° C.

127 . The nucleotide acid molecule of any one of claims 123 - 126 , wherein A or C has a GC content between 30% and 80%, or between 30% and 70%.

128 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 19)

5′-CCACTGCACTCCAGCCTG(N 1-6 )CTTCAGCTTCCCGATTACGGGC

ACGATCCGACGGTAGTGT(N 1-6 )GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

129 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 20)

5′-TCTCCTGCCTCAGCCTCC(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )AGGCTGGAGTGCAGTGGC-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

130 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 21)

5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

131 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 22)

5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

132 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 23)

5′-CCACTGCACTCCAGCCTG(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GGAGGCTGAGGCAGGAGA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

133 . A nucleic acid molecule comprising a nucleotide sequence of

(SEQ ID NO: 24)

5′-CACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )CAGGAGGCTGAGGCAGGA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

134 . A nucleic acid molecule comprising a nucleotide sequence of 5′-

(SEQ ID NO: 25)

ACTGCACTCCAGCCTGG(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GGAGGCTGAGGCAGGAG-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

135 . A nucleic acid molecule comprising a nucleotide sequence of 5′-

(SEQ ID NO: 26)

TGCACTCCAGCCTGGGCA(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

136 . A nucleic acid molecule comprising a nucleotide sequence of 5′-

(SEQ ID NO: 27)

CTGCACTCCAGCCTGGGC(N 1-6 )CTTCAGCTTCCCGATTACGGG

CACGATCCGACGGTAGTGT(N 7-12 )GAGGCTGAGGCAGGAGAA-3′,

wherein (N 1-6 ) represents a first unique molecular tag and (N 7-12 ) represents a second unique molecular tag.

137 . The method of any one of claims 1 - 80 , wherein the MIP comprises the nucleic acid molecule of any one of claims 123 - 136 .

Assignments (2)
CHANGE OF NAME Recorded May 16, 2022
From: PROGENITY, INC.
To: BIORA THERAPEUTICS, INC.
Reel/Frame 060072/0817 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Feb 12, 2021
From: MANN, TOBIAS; WANG, HENG; KIM, JUNG H.; SEKEDAT, MATTHEW
To: PROGENTITY, INC.
Reel/Frame 055246/0354 →