Expression control using a regulatable intron
The present invention relates to the use of a regulatory nucleic acid sequences that are able to regulate gene expression in eukaryotic cells and which are responsive to the unfolded protein response (UPR). There are disclosed regulatable introns and UPR-inducible promoters, which are able to regulate gene expression. There are also disclosed recombinant expression constructs comprising such regulatory nucleic acid sequences, whereby expression of the encoded expression product can be induced by invoking the unfolded protein response (UPR) in a eukaryotic cell containing the construct, methods of using such constructs and associated vectors, cells and suchlike.
1. A synthetic nucleic acid expression construct for producing an expression product in a cell, the nucleic acid expression construct comprising a promoter sequence operably linked to a nucleic acid sequence encoding the expression product, the nucleic acid sequence encoding the expression product comprising a sequence which encodes a regulatable intron, said regulatable intron being an intron which comprises an excisable sequence which is capable of being spliced out of a transcript produced from the synthetic expression construct via the unfolded protein response (UPR) system in the cell, thereby resulting in a transcript encoding a functional expression product,
wherein the regulatable intron comprises the sequence CNG/CNG-Xn-CNG/CNG, wherein Xn represents a sequence of length n bases, wherein/represents a cleavage site and wherein the sequence CNG-Xn-CNG is excised from the transcript; or
wherein the regulatable intron comprises the sequence CNG/CNG-Xn-CNG/CNG[CG], wherein Xn represents a sequence of length n nucleotides, wherein/represents the cleavage site such that the excisable sequence CNG-Xn-CNG is excised from the transcript upon splicing, and wherein the nucleotide at the 5′ end of the sequence Xn is a C or G.
2. The synthetic nucleic acid expression construct of claim 1 , wherein the regulatable intron is capable of being spliced out by the IRE1 protein or a homologue or orthologue thereof.
3. The synthetic nucleic acid expression construct of claim 1 , wherein splicing out of the excisable sequence of the regulatable intron results in at least one of
a. permits correct translation of the transcript from the nucleic acid sequence encoding the expression product, thereby allowing the desired expression product to be produced;
b. eliminates a premature stop codon in the transcript; or
c. results in a shift of reading frame for sequences in the transcript located downstream of the regulatable intron.
4. The synthetic nucleic acid expression construct of claim 1 , wherein the presence of the intron in the transcript from the nucleic acid sequence encoding the expression product results in a protein being translated from the transcript which is non-functional.
5. The synthetic nucleic acid expression construct of claim 1 , wherein the length in nucleotides of the excisable sequence is not divisible by 3.
6. The synthetic nucleic acid expression construct of claim 1 , wherein Xn has a length of from 10 to 500 nucleotides, 15 to 350 nucleotides, 15 to 100 nucleotides, 15 to 35 nucleotides, or 20 to 25 nucleotides.
7. The synthetic nucleic acid expression construct of claim 1 , wherein Xn comprises the sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 1).
8. The synthetic nucleic acid expression construct of claim 1 wherein Xn comprises one of the following sequences:
(SEQ ID NO: 1)
CACUCAGACUACGUGCACCU;
(SEQ ID NO: 2)
CACUCAGACUACGUGCUCCU;
(SEQ ID NO: 3)
CACUCAGACUACGUGCCCCU;
(SEQ ID NO: 4)
CACUCAGACUACGUGCGCCU;
and
(SEQ ID NO: 5)
CACUCAGACUAUGUGCACCU.
9. The synthetic nucleic acid expression construct of claim 1 , wherein the regulatable intron comprises the sequence CNG/CNGCACUCAGACUACGUGCACCUCNG/CNGC (SEQ ID NO: 6); or
the sequence CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC (SEQ ID NO: 7).
10. The synthetic nucleic acid expression construct of claim 1 , wherein the regulatable intron comprises one of the following sequences:
(SEQ ID NO: 8)
CNG/CAGCACUCAGACUACGUGCACCUCUG/CNG;
(SEQ ID NO: 9)
CNG/CAGCACUCAGACUACGUGCUCCUCUG/CNG;
(SEQ ID NO: 10)
CNG/CAGCACUCAGACUACGUGCCCCUCUG/CNG;
(SEQ ID NO: 11)
CNG/CAGCACUCAGACUACGUGCGCCUCUG/CNG;
and
(SEQ ID NO: 12)
CNG/CAGCACUCAGACUAUGUGCACCUCUG/CNG.
11. The synthetic nucleic acid expression construct claim 1 , wherein the regulatable intron comprises one of the following sequences:
(SEQ ID NO: 7)
CAG/CAGCACUCAGACUACGUGCACCUCUG/CUGC;
(SEQ ID NO: 13)
CAG/CAGCACUCAGACUACGUGCUCCUCUG/CUGC;
(SEQ ID NO: 14)
CAG/CAGCACUCAGACUACGUGCCCCUCUG/CUGC;
(SEQ ID NO: 15)
CAG/CAGCACUCAGACUACGUGCGCCUCUG/CUGC;
and
(SEQ ID NO: 16)
CAG/CAGCACUCAGACUAUGUGCACCUCUG/CUGC.
12. The synthetic nucleic acid expression construct of claim 1 , claim wherein the regulatable intron comprises the sequence CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CUG (SEQ ID NO: 17) or CAG/CUGCAGCACUCAGACUACGUGCACCUCUG/CUGG (SEQ ID NO: 27), wherein/represents a cleavage site.
13. The synthetic nucleic acid expression construct of claim 1 , wherein the nucleic acid sequence encoding an expression product is a transgene.
14. The synthetic nucleic acid expression construct of claim 1 , wherein the nucleic acid sequence encoding an expression product encodes a protein, an enzyme, an antibody or antibody fragment, a viral protein, a therapeutic protein, or a toxic protein.
15. A vector comprising a synthetic nucleic acid expression construct of claim 1 .
16. A pharmaceutical composition comprising a synthetic nucleic acid expression construct of claim 1 .
17. A cell comprising a synthetic nucleic acid expression construct of claim 1 .
18. The cell of claim 17 , wherein the nucleic acid expression construct of claim 1 encodes an expression product that is toxic to the cell.
19. A method for producing an expression product, the method comprising:
a) providing a population of eukaryotic cells comprising a synthetic nucleic acid expression construct of claim 1 ;
b) treating said population of cells so as to induce the unfolded protein response, thereby inducing splicing of the excisable sequence out of the regulatable intron;
c) incubating said population of cells under suitable conditions for production of the expression product; and
d) isolating the expression product from said population of cells.
20. A method for gene therapy in a subject in need of said gene therapy comprising:
introducing into the subject a gene therapy vector comprising a nucleic acid expression construct of claim 1 , the nucleic acid expression construct comprising a sequence encoding a therapeutic expression product such that the gene therapy vector delivers the nucleic acid expression construct to target cells of the subject; and
expressing a therapeutically effective amount of the functional therapeutic expression product in target cells of subject.