Oligonucleotide compounds for treatment of preeclampsia and other angiogenic disorders
This disclosure relates to novel targets for angiogenic disorders. Novel oligonucleotides are also provided. Methods of using the novel oligonucleotides for the treatment of angiogenic disorders (e.g., preeclampsia) are also provided.
1. A compound comprising an RNA molecule that is between 15 and 35 bases in length having a 5′ end, a 3′ end and complementarity to an intronic region of an mRNA encoding an sFLT1 protein, wherein the RNA molecule comprises a hydrophobic modification.
2. The compound of claim 1 , comprising double stranded (ds) RNA molecule having a sense strand and an antisense strand.
3. The compound of claim 2 , wherein the antisense strand comprises a region of complementarity which is substantially complementary to
(SEQ ID NO: 1)
5′ CTCTCGGATCTCCAAATTTA 3′,
(SEQ ID NO: 2)
5′ CATCATAGCTACCATTTATT 3′,
(SEQ ID NO: 3)
5′ ATTGTACCACACAAAGTAAT 3′
or
(SEQ ID NO: 4)
5′ GAGCCAAGACAATCATAACA 3′.
4. The dsRNA of claim 3 , wherein said region of complementarity is complementary to at least 15 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
5. The dsRNA of claim 3 , wherein said dsRNA
comprises at least one single stranded nucleotide overhang.
6. The dsRNA of claim 5 , wherein said dsRNA comprises at least one modified nucleotide selected from the group consisting of a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a terminal nucleotide linked to a cholesteryl derivative, a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, and a non-natural base nucleotide.
7. The dsRNA of claim 2 , said dsRNA comprising a 5′ end, a 3′ end, complementarity to a target, a first oligonucleotide, and a second oligonucleotide, wherein:
(1) the first oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4;
(2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide;
(3) the second oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;
(4) the nucleotides at positions 2 and 14 from the 3′ end of the second oligonucleotide comprise 2′-methoxy-ribonucleotides; and
(5) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages.
8. The compound of claim 1 , wherein
the sFLT1 protein is selected from the group consisting of one or any combination of sFLT1-i13 short, sFLT1-i13 long and sFlt-i15a.
9. A composition comprising a first dsRNA comprising a first sense strand and a first antisense strand and a second dsRNA comprising a second sense strand and a second antisense strand, wherein the first antisense strand comprises a first region of complementarity which is substantially complementary to SEQ ID NO: 1 and the second antisense strand comprises a second region of complementarity which is substantially complementary to SEQ ID NO:2.
10. The composition of claim 9 , wherein each dsRNA comprises at least one modified nucleotide.
11. The composition of claim 9 , wherein each dsRNA comprises a 5′ end, a 3′ end and complementarity to a target, wherein:
(1) the nucleotides comprise alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;
(2) the nucleotides at positions 2 and 14 from the 5′ end are not 2′-methoxy-ribonucleotides;
(3) the nucleotides are connected via phosphodiester or phosphorothioate linkages; and
(4) the nucleotides at positions 1-6 from the 3′ end, or positions 1-7 from the 3′ end, are connected to adjacent nucleotides via phosphorothioate linkages.
12. A pharmaceutical composition comprising:
a first dsRNA comprising a first sense strand and a first antisense strand, wherein the first antisense strand comprises a region of complementarity which is substantially complementary to one or both of an intronic region of sFLT-i13 short and an intronic region of sFLT-i13 long;
a second dsRNA comprising a second sense strand and a second antisense strand, wherein the second antisense strand comprises a region of complementarity which is substantially complementary to an intronic region of sFLT-i15a; and
a pharmaceutically acceptable carrier.
13. A method of treating or managing PE, postpartum PE, eclampsia or HELLP syndrome comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 12 .
14. The method of claim 13 , wherein the pharmaceutical composition is administered intravenously or subcutaneously.
15. A method of treating one or more symptoms of PE, postpartum PE, eclampsia or HELLP syndrome in a subject in need thereof, comprising administering to the subject the composition of claim 9 .
16. A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to the subject the compound of claim 3 .
17. The method of claim 16 , wherein the angiogenic disorder is selected from the group consisting of PE, postpartum PE, eclampsia and HELLP syndrome.
18. The nucleic acid of claim 7 , wherein
the hydrophobic molecule comprises a molecule selected from the group consisting of: omega-3 fatty acid, docosanoic acid (DCA), lysophosphatidylcholine esterified DCA (g2-DCA), docosahexaenoic acid (DHA), lysophosphatidylcholine esterified DHA (g2-DHA) and eicosapentaenoic acid (EPA).
19. The compound of claim 2 , wherein the antisense strand comprises a region of complementarity which contains no more than 3 mismatches with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
20. The dsRNA of claim 3 , wherein said region of complementarity contains no more than 3 mismatches with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
21. The dsRNA of claim 3 , wherein said region of complementarity is fully complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
22. The dsRNA of claim 5 , wherein said dsRNA comprises at least one 2′-O-methyl modified nucleotide, at least one 2′-fluoro modified nucleotide, at least one nucleotide comprising a 5′phosphorothioate group or a terminal nucleotide linked to a cholesteryl derivative.
23. The dsRNA of claim 7 , wherein the second oligonucleotide is linked to the hydrophobic molecule at the 3′ end of the second oligonucleotide.
24. The dsRNA of claim 7 , wherein the nucleotides at positions 1 and 2 from the 3′ end of second oligonucleotide are connected to adjacent nucleotides via phosphorothioate linkages.
25. The dsRNA of claim 7 , the nucleotides at positions 1 and 2 from the 3′ end of second oligonucleotide, and the nucleotides at positions 1 and 2 from the 5′ end of second oligonucleotide, are connected to adjacent ribonucleotides via phosphorothioate linkages.
26. The pharmaceutical composition of claim 12 , wherein the first oligonucleotide binds an intronic region of both sFLT1-i13 short and sFLT1-i13 long.
27. The pharmaceutical composition of claim 12 , wherein one or both of the first dsRNA or second dsRNA comprises a hydrophobic modification.
28. The pharmaceutical composition of claim 12 , wherein the first antisense strand comprises a region of complementarity which is fully complementary to SEQ ID NO:1 and the second antisense strand comprises a region of complementarity which is fully complementary to SEQ ID NO:2.