TMPRSS6 iRNA compositions and methods of use thereof
The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the TMPRSS6 gene, and methods of using such RNAi agents to inhibit expression of TMPRSS6 and methods of treating subjects having a TMPRSS6 associated disorder, e.g., an iron overload associated disorder, such as β-thalassemia or hemochromatosis.
1. A double stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region,
wherein the antisense strand comprises at least 15 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187),
wherein each strand is independently 15 to 30 nucleotides in length,
wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides,
wherein the double stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages, and
wherein at least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached at the 3′-terminus, the 5′-terminus or both termini.
2. A double stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region,
wherein the antisense strand comprises at least 16 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187),
wherein each strand is independently 15 to 30 nucleotides in length,
wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides,
wherein the double stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages, and
wherein at least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached at the 3′-terminus, the 5′-terminus or both termini.
3. A double stranded RNAi agent for inhibiting expression of TMPRSS6 in a cell, comprising a sense strand and an antisense strand forming a double-stranded region,
wherein the antisense strand comprises at least 17 contiguous nucleotides which differ by no more than three nucleotides from the nucleotide sequence AGAAUGAACCAGAAGAAGCAGGU (SEQ ID NO:187),
wherein each strand is independently 15 to 30 nucleotides in length,
wherein all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides,
wherein the double stranded RNAi agent comprises 6-8 phosphorothioate internucleotide linkages, and
wherein at least one strand is conjugated to an N-acetylgalactosamine (GalNAc) derivative ligand attached at the 3′-terminus, the 5′-terminus or both termini.
4. The double stranded RNAi agent of any one of claims 1 - 3 , wherein each strand is independently 17-25 nucleotides in length.
5. The double stranded RNAi agent of any one of claims 1 - 3 , wherein each strand is independently 19-25 nucleotides in length.
6. The double stranded RNAi agent of any one of claims 1 - 3 , wherein each strand is independently 19-23 nucleotides in length.
7. The double stranded RNAi agent of any one of claims 1 - 3 , wherein at least one of the modified nucleotides is selected from the group consisting of a 3′-terminal deoxy-thymine (dT) nucleotide, a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2′-amino-modified nucleotide, a 2′-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a nucleotide comprising a 5′-phosphorothioate group, a nucleotide comprising a 5′ phosphate or 5′ phosphate mimic, and a terminal nucleotide linked to a cholesteryl derivative or a dodecanoic acid bisdecylamide group.
8. The double stranded RNAi agent of any one of claims 1 - 3 , wherein at least one of the modified nucleotides is selected from the group consisting of a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, an abasic nucleotide, and a 2′-amino modified nucleotide.
9. The double stranded RNAi agent of any one of claims 1 - 3 , wherein at least one strand comprises an overhang of at least 1 nucleotide.
10. The double stranded RNAi agent of any one of claims 1 - 3 , wherein at least one of the phosphorothioate internucleotide linkages is at the 3′-terminus of one strand.
11. The double stranded RNAi agent of claim 10 , wherein the strand is the antisense strand.
12. The double stranded RNAi agent of claim 10 , wherein the strand is the sense strand.
13. The double stranded RNAi agent of any one of claims 1 - 3 , wherein at least one of the phosphorothioate internucleotide linkages is at the 5′-terminus of one strand.
14. The double stranded RNAi agent of claim 13 , wherein the strand is the antisense strand.
15. The double stranded RNAi agent of any one of claims 1 - 3 , wherein the phosphorothioate internucleotide linkages are at both the 5′- and the 3′-terminus of one strand.
16. The double stranded RNAi agent of claim 15 , wherein the strand is the antisense strand.
17. A pharmaceutical composition for inhibiting expression of a TMPRSS6 gene comprising the double stranded RNAi agent of claim 1 .
18. A pharmaceutical composition for inhibiting expression of a TMPRSS6 gene comprising the double stranded RNAi agent of claim 2 .
19. A pharmaceutical composition for inhibiting expression of a TMPRSS6 gene comprising the double stranded RNAi agent of claim 3 .
20. The double stranded RNAi agent of any one of claims 1 - 3 , wherein the N-acetylgalactosamine (GalNAc) derivative ligand is attached through a trivalent branched linker.
21. The double stranded the RNAi agent of claim 20 , wherein the trivalent branched linker comprises the structure shown in Formula (VII):