Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising:
(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, and
(2) a non-naturally occurring DNA-targeting RNA that comprises:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and
(ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
2. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
3. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are two separate RNA molecules.
4. The composition of claim 1 , comprising a protein-RNA complex that comprises the Cas9 protein and the non-naturally occurring DNA-targeting RNA.
5. The composition of claim 4 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
6. The composition of claim 1 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
7. The composition of claim 6 , wherein the Cas9 protein is an S. pyogenes Cas9.
8. The composition of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide.
9. The composition of claim 1 , wherein the Cas9 protein is fused to a heterologous polypeptide that comprises one or more of: a protein tag, an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, and green fluorescent protein.
10. The composition of claim 1 , wherein the Cas9 protein is an S. pyogenes Cas9.
11. The composition of claim 1 , wherein the non-naturally occurring DNA-targeting RNA comprises one or more of said non-natural internucleoside linkage, and thereby comprises one or more of: a phosphorothioate, a phosphoramidate, a non-phosphodiester, a heteroatom, a chiral phosphorothioate, a phosphorodithioate, a phosphotriester, an aminoalkylphosphotriester, a 3′-alkylene phosphonates, a 5′-alkylene phosphonate, a chiral phosphonate, a phosphinate, a 3′-amino phosphoramidate, an aminoalkylphosphoramidate, a phosphorodiamidate, a thionophosphoramidate, a thionoalkylphosphonate, a thionoalkylphosphotriester, a selenophosphate, and a boranophosphate.
12. The composition of claim 1 , wherein the non-naturally occurring DNA-targeting RNA comprises one or more of said modified sugar moiety, and thereby comprises one or more of: a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-dimethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a 2′-O-methyl modified sugar moiety, and a 2′-fluoro modified sugar moiety.
13. The composition of claim 1 , wherein the non-naturally occurring DNA-targeting RNA comprises one or more of said modified nucleobase, and thereby comprises one or more of: a 5-methylcytosine; a 5-hydroxymethyl cytosine; a xanthine; a hypoxanthine; a 2-aminoadenine; a 6-methyl derivative of adenine; a 6-methyl derivative of guanine; a 2-propyl derivative of adenine; a 2-propyl derivative of guanine; a 2-thiouracil; a 2-thiothymine; a 2-thiocytosine; a 5-halouracil; a 5-halocytosine; a 5-propynyl uracil; a 5-propynyl cytosine; a 6-azo uracil; a 6-azo cytosine; a 6-azo thymine, a pseudouracil; a 4-thiouracil; an 8-halo; an 8-amino; an 8-thiol; an 8-thioalkyl; an 8-hydroxyl; a 5-halo; a 5-bromo; a 5-trifluoromethyl; a 5-substituted uracil; a 5-substituted cytosine; a 7-methylguanine; a 7-methyladenine; a 2-F-adenine; a 2 amino-adenine; all 8-azaguanine; an 8-azaadenine; a 7-deazaguanine; a 7-deazaadenine; a 3-deazaguanine; a 3-deazaadenine; a tricyclic pyrimidine; a phenoxazine cytidine; a phenothiazine cytidine; a substituted phenoxazine cytidine; a carbazole cytidine; a pyridoindole cytidine; a 7-deaza-adenine; a 7-deazaguanosine; a 2-aminopyridine; a 2-pyridone; a 5-substituted pyrimidine; a 6-azapyrimidine; an N-2, N-6 or O-6 substituted purine; a 2-aminopropyladenine; a 5-propynyluracil; and a 5-propynylcytosine.
14. The composition of claim 1 , wherein the non-naturally occurring DNA-targeting RNA comprises one or more of said nucleic acid mimetic, and said nucleic acid mimetic is a peptide nucleic acid (PNA), a morpholine nucleic acid, a cyclohexenyl nucleic acid (CeNA), or a locked nucleic acid (LNA).
15. The composition of claim 1 , wherein the non-naturally occurring DNA-targeting RNA comprises the non-natural internucleoside linkage and/or the modified sugar moiety.
16. A composition comprising:
(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, and
(2) a non-naturally occurring DNA-targeting RNA that comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and
(ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex; wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
17. The composition of claim 16 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
18. The composition of claim 16 , wherein the targeter-RNA and the activator-RNA are two separate RNA molecules.
19. The composition of claim 16 , comprising a protein-RNA complex that comprises the Cas9 protein and the non-naturally occurring DNA-targeting RNA.
20. The composition of claim 19 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
21. The composition of claim 16 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
22. The composition of claim 16 , comprising the nucleic acid encoding the Cas9 protein, wherein the nucleic acid encoding the Cas9 protein is an RNA.
23. The composition of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide.
24. The composition of claim 16 , wherein the Cas9 protein is an S. pyogenes Cas9.
25. The composition of claim 16 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441) or the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432).
26. A composition comprising:
(1) a Cas9 protein, and
(2) a non-naturally occurring DNA-targeting RNA or a nucleic acid encoding the non-naturally occurring DNA-targeting RNA, wherein the non-naturally occurring DNA-targeting RNA comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and
(ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the non-naturally occurring DNA-targeting RNA is capable of forming a complex with the Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
27. The composition of claim 26 , wherein the activator-RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441) or the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU UUU (SEQ ID NO: 432).
28. The composition of claim 26 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
29. The composition of claim 26 , wherein the Cas9 protein s fused to a heterologous polypeptide.
30. The composition of claim 26 , wherein the Cas9 protein is an S. pyogenes Cas9.