Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising:
a nucleic acid encoding a single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs, and
wherein the activator-RNA and the targeter-RNA are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
2. The composition of claim 1 , further comprising the Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the activator-RNA and the Cas9 protein do not naturally occur together.
3. The composition of claim 2 , wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
4. The composition of claim 2 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
5. The composition of claim 1 , wherein the single molecule DNA-targeting RNA comprises a 103 nucleotide (nt) sequence that comprises, in 5′ to 3′ order:
a 20 nucleotide (nt) targeting sequence that is said nucleotide sequence that is complementary to the target sequence of the target DNA;
a 12 nt crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679),
a 4 nt linker sequence GAAA, and
a 67 nt tracrRNA sequence
(SEQ ID NO: 432)
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCAC
CGAGUCGGUGCUUUUUUU.
6. The composition of claim 1 , wherein the activator-RNA and the targeter-RNA are covalently linked by 3-5 intervening nucleotides.
7. The composition of claim 1 , wherein the activator-RNA and the targeter-RNA are covalently linked by 4 intervening nucleotides.
8. The composition of claim 1 , wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 18 to 25 nucleotides long.
9. A composition comprising:
a nucleic acid encoding a single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising a nucleotide sequence that is complementary to a target sequence of a target DNA; and (ii) an activator-RNA that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs, and wherein the activator-RNA and the targeter-RNA are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
10. The composition of claim 9 , further comprising the Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the activator-RNA and the Cas9 protein do not naturally occur together.
11. The composition of claim 10 , wherein the nucleic acid encoding the single molecule DNA-targeting RNA is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
12. The composition of claim 10 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
13. The composition of claim 9 , wherein the activator-RNA and the targeter-RNA are covalently linked by 3-5 intervening nucleotides.
14. The composition of claim 9 , wherein the activator-RNA and the targeter-RNA are covalently linked by 4 intervening nucleotides.
15. The composition of claim 9 , wherein the nucleotide sequence that is complementary to the target sequence in the target DNA molecule is 15 to 25 nucleotides long.
16. A composition comprising:
(1) Cas9 protein or a nucleic acid encoding the Cas9 protein; and
(2) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising: (1) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and
(ii) the activator-RNA which that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the activator-RNA and the targeter-RNA are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
17. The composition of claim 16 , wherein the first and second nucleotide sequences are heterologous to one another.
18. The composition of claim 17 , wherein the Cas9 protein is an S. pyogenes Cas9.
19. The composition of claim 17 , comprising the nucleic acid encoding the Cas9 protein and the nucleic acid encoding the single molecule DNA-targeting RNA.
20. The composition of claim 17 , comprising a protein-RNA complex that comprises the Cas9 protein and the single molecule DNA-targeting RNA.
21. The composition of claim 17 , wherein the activator-RNA comprises the 67 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUUUUU (SEQ ID NO: 432) or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 441).
22. The composition of claim 16 , wherein the Cas9 protein is fused to a heterologous polypeptide.
23. The composition of claim 16 , wherein the activator-RNA and the targeter-RNA are covalently linked by 3-5 intervening nucleotides.
24. The composition of claim 16 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more of: a non-natural internucleoside linkage, a nucleic acid mimetic, a modified sugar moiety, and a modified nucleobase.
25. The composition of claim 16 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more of: a phosphorothioate, an inverted polarity linkage, an abasic nucleoside linkage, a locked nucleic acid (LNA), a 2′-O-methoxyethyl modified sugar moiety, a 2′-O-methyl modified sugar moiety, a 2′-O-(2-methoxyethyl) modified sugar moiety, a 2′-fluoro modified sugar moiety, a 2′-dirnethylaminooxyethoxy modified sugar moiety, a 2′-dimethylaminoethoxyethoxy modified sugar moiety, a peptide nucleic acid (PNA), a morpholino nucleic acid, and a cyclohexenyl nucleic acid (CeNA).
26. The composition of claim 16 , wherein the single molecule DNA-targeting RNA, or the nucleic acid encoding the single molecule DNA-targeting RNA, is conjugated to one or more of: a polyamine; a polyamide; a polyethylene glycol; a polyether; a cholesterol moiety; a cholic acid; a thioether; a thiocholesterol; an aliphatic chain; a phospholipid; an adamantane acetic acid; a palmityl moiety; an octadecylamine moiety; a hexylamino-carbonyl-oxycholesterol moiety; a biotin; a phenazine; a folate; a phenanthridine; an anthraquinone; an acridine; a fluorescein; a rhodamine; a dye; and a coumarin.
27. A composition comprising:
(1) Cas9 protein or a nucleic acid encoding the Cas9 protein; and
(2) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises, in 5′ to 3′ order:
(i) a targeter-RNA comprising: (1) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and
(ii) the activator-RNA which that hybridizes with the targeter-RNA to form a double-stranded RNA duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 15 to 18 base pairs,
wherein the activator-RNA and the targeter-RNA are covalently linked by intervening nucleotides, wherein the single molecule DNA-targeting RNA is capable of forming a complex with a Cas9 protein and hybridization of the targeter-RNA to the target sequence is capable of targeting the complex to the target DNA.
28. The composition of claim 27 , wherein the first and second nucleotide sequences are heterologous to one another.
29. The composition of claim 27 , wherein the Cas9 protein is fused to a heterologous polypeptide.
30. The composition of claim 28 , wherein the Cas9 protein is an S. pyogenes Cas9.