Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA comprising: (1) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and
(ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA.
2. The composition of claim 1 , wherein the first nucleotide sequence is 18 to 25 nucleotides long.
3. The composition of claim 1 , wherein said intervening nucleotides are 3-5 nucleotides.
4. The composition of claim 1 , wherein the Cas9 protein comprises a mutation in a RuvC or an HNH domain.
5. The composition of claim 1 , further comprising a nuclease inhibitor.
6. The composition of claim 1 , wherein the Cas9 protein comprises a heterologous polypeptide.
7. The composition of claim 6 , wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein.
8. The composition of claim 1 , wherein the Cas9 protein is fused to a protein transduction domain (PTD).
9. The composition of claim 1 , wherein the composition comprises a protein-RNA complex comprising the Cas9 protein and the single molecule DNA-targeting RNA.
10. The composition of claim 1 , further comprising a donor polynucleotide.
11. The composition of claim 1 , comprising the single molecule DNA-targeting RNA and the nucleic acid encoding the Cas9 protein.
12. The composition of claim 11 , wherein the nucleic acid encoding the Cas9 protein is an RNA.
13. The composition of claim 11 , further comprising a donor polynucleotide.
14. The composition of claim 1 , comprising the nucleic acid encoding the Cas9 protein and/or the nucleic acid encoding the single molecule DNA-targeting RNA.
15. The composition of claim 14 , wherein the nucleic acid encoding the Cas9 protein is an RNA.
16. The composition of claim 14 , wherein the nucleic acid encoding the Cas9 protein is a DNA.
17. The composition of claim 14 , wherein the nucleic acid encoding the Cas9 protein and/or the nucleic acid encoding the single molecule DNA-targeting RNA, is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
18. The composition of claim 1 , wherein the first and second nucleotide sequences are heterologous to one another.
19. The composition of claim 1 , wherein:
(1) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUUUUU (SEQ ID NO: 432); or
(2) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397); or
(3) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUUUUU (SEQ ID NO: 432).
20. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, and/or one or more modified nucleobases.
21. The composition of claim 20 , wherein the single molecule DNA-targeting RNA comprises said one or more non-natural internucleoside linkages and/or said one or more modified sugar moieties.
22. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, and/or one or more cyclohexenyl nucleic acids (CeNAs).
23. The composition of claim 22 , wherein the single molecule DNA-targeting RNA comprises said one or more 2′-O-methyl modified sugar moieties and/or said one or more 2′-fluoro modified sugar moieties.
24. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.
25. A composition comprising one or more nucleic acids, wherein said one or more nucleic acids encode:
(a) a Cas9 protein that is a Streptococcus pyogenes Cas9; and
(b) a single molecule DNA-targeting RNA comprising in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA.
26. The composition of claim 25 , wherein at least one of said one or more nucleic acids is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
27. A kit comprising:
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA; and
wherein (a) and (b) are separated.
28. The kit of claim 27 , wherein the Cas9 protein comprises a heterologous polypeptide.
29. A composition comprising
(a) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA comprising: (1) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (2) a second nucleotide sequence that hybridizes with an activator-RNA; and
(ii) the activator-RNA, which hybridizes with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432), and
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA.
30. The composition of claim 29 , wherein said first sequence is 15-25 nucleotides long and the single molecule DNA-targeting RNA comprises the nucleotide sequence set forth as SEQ ID NO: 682 such that the single molecule DNA-targeting RNA comprises the nucleotide sequence N15-25 UUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 682).