Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 with one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and guiding the complex to the target sequence of the target DNA.
2. The composition of claim 1 , wherein the first nucleotide sequence is 18 to 25 nucleotides long.
3. The composition of claim 2 , wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein.
4. The composition of claim 1 , wherein said intervening nucleotides are 3-5 nucleotides.
5. The composition of claim 1 , wherein the Cas9 polypeptide has reduced nuclease activity.
6. The composition of claim 1 , wherein the Cas9 polypeptide has substantially no nuclease activity.
7. The composition of claim 1 , wherein the heterologous polypeptide comprises a transcriptional activator polypeptide or a transcription repressor polypeptide.
8. The composition of claim 7 , wherein the Cas9 polypeptide has substantially no nuclease activity.
9. The composition of claim 1 , wherein the heterologous polypeptide has DNA-modifying activity.
10. The composition of claim 9 , wherein the DNA modifying activity is methyltransferase activity, demethylase activity, DNA repair activity, DNA damage activity, deamination activity, dismutase activity, alkylation activity, depurination activity, oxidation activity, pyrimidine dimer forming activity, integrase activity, transposase activity, recombinase activity, polymerase activity, ligase activity, helicase activity, photolyase activity, or glycosylase activity.
11. The composition of claim 1 , wherein the heterologous polypeptide has protein-modifying activity.
12. The composition of claim 1 , wherein the heterologous polypeptide has histone-modifying activity.
13. The composition of claim 12 , wherein the Cas9 polypeptide has substantially no nuclease activity.
14. The composition of claim 1 , wherein the heterologous polypeptide has deamination activity, polymerase activity, demethylase activity, methyltransferase activity, or transposase activity.
15. The composition of claim 1 , wherein the chimeric Cas9 protein is fused to a protein transduction domain (PTD).
16. The composition of claim 1 , wherein the composition comprises a protein-RNA complex comprising the chimeric Cas9 protein and the single molecule DNA-targeting RNA.
17. The composition of claim 1 , comprising the single molecule DNA-targeting RNA and/or the nucleic acid encoding the chimeric Cas9 protein, wherein the nucleic acid encoding the chimeric Cas9 protein is an RNA.
18. The composition of claim 1 , comprising the nucleic acid encoding the chimeric Cas9 protein and/or the nucleic acid encoding the single molecule DNA-targeting RNA.
19. The composition of claim 18 , wherein the nucleic acid encoding the chimeric Cas9 protein and/or the nucleic acid encoding the single molecule DNA-targeting is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
20. The composition of claim 1 , wherein:
(1) the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432); or
(2) the activator RNA comprises the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397); or
(3) the targeter-RNA comprises the 12 nucleotide (nt) crRNA sequence GUUUUAGAGCUA (SEQ ID NO: 679), the intervening nucleotides comprise the 4 nt sequence GAAA, and the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUUUUUU (SEQ ID NO: 432).
21. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, and/or one or more modified nucleobases.
22. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, and/or one or more cyclohexenyl nucleic acids (CeNAs).
23. The composition of claim 22 , wherein the single molecule DNA-targeting RNA comprises said one or more 2′-O-methyl modified sugar moieties and/or said one or more 2′-fluoro modified sugar moieties.
24. The composition of claim 1 , comprising the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises a heterologous moiety.
25. A composition comprising
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 with one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432),
and wherein the single molecule DNA-targeting RNA is capable of forming a complex with the chimeric Cas9 protein and guiding the complex to the target sequence of the target DNA.
26. The composition of claim 25 , wherein said target sequence is 15-25 nucleotides long and the single molecule DNA-targeting RNA comprises the nucleotide sequence set forth as SEQ ID NO: 682 such that the single molecule DNA-targeting RNA comprises the nucleotide sequence N15-25 UUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA AAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID NO: 682).
27. A composition comprising one or more nucleic acids, wherein said one or more nucleic acids encode:
(a) a chimeric Cas9 protein comprising a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 with one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA comprising in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence of the target DNA.
28. The composition of claim 27 , wherein at least one of said one or more nucleic acids is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
29. A kit comprising:
(a) a chimeric Cas9 protein or a nucleic acid encoding the chimeric Cas9 protein, wherein the chimeric Cas9 protein comprises a Cas9 polypeptide fused to a heterologous polypeptide, wherein the Cas9 polypeptide is a Streptococcus pyogenes Cas9 with one or more mutations in a RuvC domain and/or an HNH domain; and
(b) a single molecule DNA-targeting RNA or a nucleic acid encoding the single molecule DNA-targeting RNA, wherein the single molecule DNA-targeting RNA comprises in 5′ to 3′ order:
(i) a targeter-RNA that is capable of hybridizing with a target sequence of a target DNA and
(ii) an activator-RNA that is capable of hybridizing with the targeter-RNA to form a double-stranded duplex,
wherein (i) and (ii) are covalently linked by intervening nucleotides,
wherein the single molecule DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence of the target DNA; and
wherein (a) and (b) are separated.
30. The kit of claim 28 , wherein the heterologous polypeptide has deamination activity, polymerase activity, demethylase activity, methyltransferase activity, or transposase activity.