Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription
The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms.
1. A composition comprising
(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(2) a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence of the target DNA.
2. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are not covalently linked to one another by intervening nucleotides.
3. The composition of claim 1 , wherein the targeter-RNA and the activator-RNA are two separate RNA molecules.
4. The composition of claim 1 , wherein the first nucleotide sequence is 18 to 25 nucleotides long.
5. The composition of claim 1 , further comprising a nuclease inhibitor.
6. The composition of claim 1 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
7. The composition of claim 1 , wherein the Cas9 protein comprises a heterologous polypeptide.
8. The composition of claim 7 , wherein the heterologous polypeptide comprises an endosomolytic domain, an influenza HA domain, an IF2 domain, a GST domain, a GRPE domain, a 6×His tag, a hemagglutinin (HA) tag, or green fluorescent protein.
9. The composition of claim 1 , wherein the Cas9 protein is fused to a protein transduction domain (PTD).
10. The composition of claim 1 , wherein the DNA-targeting RNA is capable of firming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA.
11. The composition of claim 10 , further comprising a donor polynucleotide.
12. The composition of claim 1 , wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence to cleave the target DNA.
13. The composition of claim 12 , further comprising a donor polynucleotide.
14. The composition of claim 1 , wherein the composition comprises a protein-RNA complex comprising the Cas9 protein and the DNA-targeting RNA.
15. The composition of claim 1 , comprising the DNA-targeting RNA and the nucleic acid encoding the Cas9 protein.
16. The composition of claim 1 , comprising the nucleic acid encoding the Cas9 protein and/or the one or more nucleic acids encoding the DNA-targeting RNA.
17. The composition of claim 16 , wherein the nucleic acid encoding the Cas9 protein is an RNA.
18. The composition of claim 16 , wherein the nucleic acid encoding the Cas9 protein is a DNA.
19. The composition of claim 16 , wherein the nucleic acid encoding the Cas9 protein and/or the one or more nucleic acids encoding the DNA-targeting RNA, is a plasmid, a cosmid, a minicircle, a phage, or a viral vector.
20. The composition of claim 1 , wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432); or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ ID NO: 397).
21. The composition of claim 1 , comprising the DNA-targeting RNA, wherein the DNA-targeting RNA comprises one or more non-natural internucleoside linkages, one or more nucleic acid mimetics, one or more modified sugar moieties, and/or one or more modified nucleobases.
22. The composition of claim 1 , comprising the DNA-targeting RNA, wherein the DNA-targeting RNA comprises one or more phosphorothioates, one or more inverted polarity linkages, one or more abasic nucleoside linkages, one or more locked nucleic acids (LNAs), one or more 2′-O-methoxyethyl modified sugar moieties, one or more 2′-O-methyl modified sugar moieties, one or more 2′-O-(2-methoxyethyl) modified sugar moieties, one or more 2′-fluoro modified sugar moieties, one or more 2′-dimethylaminooxyethoxy modified sugar moieties, one or more 2′-dimethylaminoethoxyethoxy modified sugar moieties, one or more peptide nucleic acids (PNAs), one or more morpholino nucleic acids, and/or one or more cyclohexenyl nucleic acids (CeNAs).
23. The composition of claim 22 , wherein the DNA-targeting RNA comprises said one or more 2′-O-methyl modified sugar moieties and/or said one or more 2′-fluoro modified sugar moieties.
24. The composition of claim 1 , comprising the DNA-targeting RNA, wherein the targeter-RNA and/or the activator-RNA are conjugated to a heterologous moiety.
25. A composition comprising
(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(2) a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 15 base pairs,
wherein the activator-RNA comprises the 67 nt tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432), and
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence of the target DNA.
26. A kit comprising:
(1) a Cas9 protein or a nucleic acid encoding the Cas9 protein, wherein the Cas9 protein is a Streptococcus pyogenes Cas9; and
(2) a DNA-targeting RNA, or one or more nucleic acids encoding the DNA-targeting RNA, wherein the DNA-targeting RNA comprises:
(a) a targeter-RNA comprising:
(i) a first nucleotide sequence that is complementary to a target sequence of a target DNA, and (ii) a second nucleotide sequence that hybridizes with an activator-RNA, wherein the first and second nucleotide sequences are heterologous to one another; and
(b) the activator-RNA, which hybridizes with the second nucleotide sequence of the targeter-RNA to form a double-stranded RNA (dsRNA) duplex, wherein the activator-RNA hybridizes with the targeter-RNA to form a total of 8 to 1 base pairs,
wherein the DNA-targeting RNA is capable of forming a complex with the Cas9 protein and guiding the complex to the target sequence of the target DNA; and
wherein (a) and (b) are separated.
27. The kit of claim 26 , wherein the first nucleotide sequence is 18 to 25 nucleotides long.
28. The kit of claim 26 , wherein the activator-RNA comprises the 67 in tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGU GCUUUUUUU (SEQ ID NO: 432); or the 26 nucleotide tracrRNA sequence UAGCAAGUUAAAAUAAGGCUAGUCCG (SEQ 11) NO: 397).
29. The kit of claim 26 , wherein the Cas9 protein comprises a mutation in a RuvC and/or an HNH domain.
30. The kit of claim 26 , wherein the Cas9 protein comprises a heterologous polypeptide.