Compositions and methods for inhibiting gene expression of Hif2alpha
RNA interference (RNAi) triggers and RNAi trigger conjugates for inhibiting the expression of Hif2α (EPAS1) gene are described. Pharmaceutical compositions comprising one or more Hif2α RNAi triggers optionally with one or more additional therapeutics are also described. Delivery of the described Hif2α RNAi triggers to tumor cells in vivo provides for inhibition of Hif2α gene expression and treatment of cancer.
1. A composition comprising an RNA interference (RNAi) trigger for inhibiting the expression of an Hif2α gene,
wherein the RNAi trigger comprises a sense strand and an antisense strand,
wherein said antisense strand comprises the base sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, or 2-19 of SEQ ID NO. 37 (UGUAAAACAAUUGUGUACUTT).
2. The composition of claim 1 , wherein the antisense strand comprises a nucleotide base sequence of nucleotides 2-19 or 2-21 of SEQ ID NO. 38 (UGUAAAACAAUUGUGUACUUU).
3. The composition of claim 1 , wherein the sense strand and/or the antisense strand further comprises a 3′ and/or 5′ extension of 1-6 nucleotides in length.
4. The composition of claim 1 , wherein a targeting group is conjugated to the RNAi trigger.
5. The composition of claim 4 , wherein the targeting group comprises a compound selected from the group consisting of: integrin-binding compound, α v β 3 integrin-binding ligand, RGD peptide ligand, and RGD mimic.
6. The composition of claim 1 , wherein a delivery polymer is conjugated to the RNAi trigger.
7. The composition of claim 1 , wherein a linking group is conjugated to the RNAi trigger.
8. The composition of claim 1 , wherein the sense strand and/or antisense strand independently comprises one or more modified nucleotides or nucleotide mimics.
9. The composition of claim 8 , wherein the sense strand contains one, two, or three 2′-deoxy-2′-fluoro modified nucleotides at positions 11, 12, and/or 13 from the 3′ end.
10. The composition of claim 8 , wherein the antisense strand contains a 2′-deoxy-2′-fluoro modified nucleotide at position 2 from the 5′ end.
11. The composition of claim 8 , wherein the antisense strand contains a 2′-deoxy-2′-fluoro modified nucleotide at position 14 from the 5′ end.
12. The composition of claim 8 , wherein the antisense strand contains one, two, three, or four 2′-F nucleotides at positions 4, 6, 8, 10, and 12 from the 5′ end.
13. The composition of claim 1 , wherein the RNAi trigger comprises one or more phosphorothioate internucleotide linkages.
14. The composition of claim 13 , wherein the antisense strand contains one, two, three, or four phosphorothioate internucleotide linkages.
15. The composition of claim 1 , further comprising one or more additional therapeutics or treatments.
16. The composition of claim 1 further comprising a pharmaceutically acceptable excipient.
17. The composition of claim 1 , wherein said composition is packaged in a kit, container, pack, dispenser, pre-filled syringes, or vials.
18. A method for inhibiting Hif2α expression in a cell, tissue, or subject, the method comprising: administering to the subject a therapeutically effective amount of a composition of claim 1 .
19. The method of claim 18 , wherein the composition is administered via subcutaneous injection.
20. The method of claim 18 , wherein the cell or tissue is a renal cell carcinoma cell.