ADENO-ASSOCIATED VIRAL VECTORS FOR THE TREATMENT OF BEST DISEASE
Aspects of the disclosure relate to methods and compositions useful for treating bestrophinopathies, such as Best Disease.
1 . A short hairpin RNA (shRNA) comprising:
a) a sense strand comprising the nucleotide sequence CGUCAAAGCUUCACAGUGU (SEQ ID NO: 2) and an antisense strand comprising the nucleotide sequence ACACUGUGAAGCUUUGACG (SEQ ID NO: 3); and
b) a loop.
2 . The shRNA of claim 1 , wherein the loop comprises the nucleotide sequence UUCAAGAGA (SEQ ID NO: 7).
3 . The shRNA of claim 1 , wherein the shRNA comprises the nucleotide sequence CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG (SEQ ID NO: 1).
4 . A vector encoding the shRNA of claim 1 .
5 . The vector of claim 4 further comprising a recombinant bestrophin (BEST1) coding sequence that does not contain a sequence targeted by the shRNA.
6 . The vector of claim 5 , wherein the recombinant BEST1 coding sequence is codon-optimized for expression in a human cell.
7 . The vector of claim 5 , wherein the recombinant BEST1 coding sequence comprises a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 9.
8 . The vector of claim 7 , wherein the recombinant BEST1 coding sequence comprises the nucleotide sequence of SEQ ID NO: 9.
9 . A vector encoding an shRNA of claim 1 and a recombinant BEST1 sequence comprising a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 11.
10 . The vector of claim 9 , wherein the vector comprises the nucleotide sequence of SEQ ID NO: 11.
11 . The vector of claim 4 , wherein the vector is a plasmid or a viral vector.
12 . (canceled)
13 . The vector of claim 11 , wherein the viral vector is a recombinant adeno-associated viral (rAAV) vector.
14 . The vector of claim 13 , wherein the rAAV vector is self-complementary.
15 . A recombinant adeno-associated viral (rAAV) particle comprising the rAAV vector of claim 13 .
16 . The rAAV particle of claim 15 , wherein the rAAV viral particle is an AAV serotype 2 (AAV2) viral particle.
17 . A composition comprising the rAAV particle of claim 15 and a pharmaceutically acceptable carrier.
18 . A method of modulating BEST1 expression in a subject, the method comprising administering to the subject the composition of claim 17 .
19 . A method of treating Best Disease in a subject, the method comprising administering to the subject the composition of claim 17 .
20 . The method of claim 19 , wherein the subject is a human subject.
21 - 24 . (canceled)
25 . A method of treating an autosomal recessive bestrophinopathy (ARB) in a human subject, the method comprising administering to the subject the composition of claim 17 .
26 - 31 . (canceled)
32 . An shRNA that comprises a nucleotide sequence that differs from the nucleotide sequence of SEQ ID NO: 1 (CGUCAAAGCUUCACAGUGUUUCAAGAGAACACUGUGAAGCUUUGACG) by 1 or 2 nucleotides.