METHODS FOR INCREASING FETAL HEMOGLOBIN CONTENT IN EUKARYOTIC CELLS AND USES THEREOF FOR THE TREATMENT OF HEMOGLOBINOPATHIES
The clinical severity of β-hemoglobinopathies is alleviated by the co-inheritance of genetic mutations causing a sustained fetal γ-globin chain production at adult age, a condition termed hereditary persistence of fetal hemoglobin (HPFH). Here, the inventors have compared the extent of fetal hemoglobin (HbF) de-repression following CRISPR/Cas9-mediated targeting of different regions of the HBG1 and HBG2 promoters in an adult erythroid cell line (HUDEP-2). They achieved a potent and pancellular HbF re-activation upon disruption of binding sites for γ-globin repressors located in both HBG1 and HBG2 genes. They validated these findings in Red Blood Cells (RBCs) derived from genome edited Sickle Cell Disease (SCD) patient hematopoietic stem/progenitor cells. Overall, this study identified a binding site for an HbF repressor as a novel and potent target for the treatment of β-hemoglobinopathies. Accordingly, the present invention relates to a method for increasing fetal hemoglobin content in a eukaryotic cell comprising the step of disrupting the binding site for Leukemia/lymphoma-related factor (LRF) in the HBG1 or HBG2 promoter.
1 . A method for increasing fetal hemoglobin content in a eukaryotic cell comprising the step of disrupting the binding site for Leukemia/lymphoma-related factor (LRF) in the HBG1 or HBG2 promoter.
2 . The method of claim 1 wherein the eukaryotic cell is selected from the group consisting of hematopoietic progenitor cells, hematopoietic stem cells (HSCs), and pluripotent cells.
3 . The method of claim 1 which comprises contacting the eukaryotic cell with an effective amount of a DNA-targeting endonuclease whereby the DNA-targeting endonuclease cleaves the genomic DNA of the cell in at least one position located in or close to the binding site for Leukemia/lymphoma-related factor (LRF) in the HBG1 or HBG2 promoter.
4 . The method of claim 3 wherein the DNA-targeting endonuclease leads to the genome editing of the −200 region in the HBG1 or HBG2 promoter.
5 . The method of claim 3 wherein the DNA targeting endonuclease cleaves the genomic sequence
between positions −198 and −197 in the HBG1 or HBG2 promoter wherein positions −198 and −197 correspond to positions 13 and 14 in SEQ ID NO:1, or
between positions −197 and −196 in the HBG1 or HBG2 wherein positions −197 and −196 correspond to positions 14 and 15 in SEQ ID NO:1, or
between positions −196 and −195 in the HBG1 or HBG2 promoter wherein positions −196 and −195 correspond to positions 15 and 16 in SEQ ID NO:1.
6 . The method of claim 3 wherein the DNA targeting endonuclease is a TALEN or a ZFN.
7 . The method of claim 3 wherein the DNA targeting endonuclease is a CRISPR-associated endonuclease.
8 . The method of claim 7 wherein the CRISPR-associated endonuclease is a Cas9 nuclease or is Cpf1 nuclease or any variant of these nucleases.
9 . The method of claim 7 which comprises the step of contacting the eukaryotic cell with an effective amount of the CRISPR-associated endonuclease and with one or more guide RNAs.
10 . The method of claim 9 wherein the one or more guide RNAs comprises:
the spacer sequence as set forth in SEQ ID NO: 2 (5′ AUUGAGAUAGUGUGGGGAAG 3′) for recruiting the CRISPR-associated endonuclease to the HBG1 and HBG2 promoters and generating double-strand breaks between positions −198 and −197 wherein positions −198 and −197 correspond to positions 13 and 14 in SEQ ID NO:1, or
the spacer sequence as set forth in SEQ ID NO: 3 (5′ CAUUGAGAUAGUGUGGGGAA 3′) for recruiting the CRISPR-associated endonuclease to the HBG1 and HBG2 promoters and generating double-strand breaks between positions −197 and −196 wherein positions −197 and −196 correspond to positions 14 and 15 in SEQ ID NO:1, or
the spacer sequence as set forth in SEQ ID NO: 4 (5′ GCAUUGAGAUAGUGUGGGGA 3′) for recruiting the CRISPR-associated endonuclease to the HBG1 and HBG2 promoters and generating double-strand breaks between positions −195 and −196 wherein positions −195 and −196 correspond to positions 15 and 16 in SEQ ID NO:1.
11 . The method of claim 10 wherein the CRISPR-associated endonuclease is pre-complexed with a guide RNA to form a ribonucleoprotein (RNP) complex.
12 . A method for increasing fetal hemoglobin levels in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of a population of eukaryotic cells obtained by the method according to claim 1 .
13 . The method of claim 12 wherein the subject suffers from sickle cell disease or β-thalassemia.
14 . A kit of parts comprising i) a CRISPR-associated endonuclease and ii) a guide RNA that comprises the sequence as set forth in SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
15 . A method for the treatment of a hemoglobinopathy in a subject in need thereof, comprising, administering to the subject a therapeutically effective amount of a population of eukaryotic cells obtained by the method according to claim 1 .
16 . The method of claim 2 wherein the pluripotent cells are embryonic stem cells (ES) or induced pluripotent stem cells (iPS).