Granted Patent B2

US 12,534,728 · App. 17/275,959 · Granted Jan 27, 2026

Inventors: Zhen Li (Westfield, NJ); Rui Zhu (San Diego, CA); Shawn A Morales (San Diego, CA)

Assignee: Arrowhead Pharmaceuticals, Inc.

C12N15/1137A61K31/713C12N2310/14C12N2310/315C12N2310/317C12N2310/321C12N2310/322C12N2310/351C12N2320/31

Abstract

Claims (66)

1 . An RNAi agent for inhibiting expression of an HSD17B13 gene, comprising:

an antisense strand, wherein the nucleotide sequence of the antisense strand comprises one of the following nucleotide sequences (5′→3′);

usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO:2); or

usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4), and

a sense strand, wherein the nucleobase sequence of the sense strand differs by 0 or 1 nucleobase from the nucleobase sequence (5′→3′) CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO: 8),

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and s represents a phosphorothioate linkage.

2 . The RNAi agent of claim 1 , wherein at least one nucleotide of the sense strand is a modified nucleotide or includes a modified internucleoside linkage.

3 . The RNAi agent of claim 2 , wherein the modified nucleotide of the sense strand is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, cyclopropyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.

4 . The RNAi agent of claim 3 , wherein the modified nucleotide of the sense strand is a 2′-O-methyl nucleotide or 2′-fluoro nucleotide.

5 . The RNAi agent of claim 1 , wherein all of the nucleotides of the sense strand of the RNAi agent are modified nucleotides.

6 . The RNAi agent of claim 1 , wherein the RNAi agent is linked to a targeting ligand.

7 . The RNAi agent of claim 6 , wherein the targeting ligand comprises N-acetyl-galactosamine.

8 . The RNAi agent of claim 7 , wherein the targeting ligand comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39) s.

9 . The RNAi agent of claim 8 , wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.

10 . The RNAi agent of claim 9 , wherein the targeting ligand is linked to the sense strand.

11 . The RNAi agent of claim 10 , wherein the targeting ligand is linked to the 5′ terminal end of the sense strand.

12 . The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.

13 . The RNAi agent of claim 1 , wherein the RNAi agent has two blunt ends.

14 . The RNAi agent of claim 1 , wherein the sense strand comprises one or two terminal caps.

15 . The RNAi agent of claim 1 , wherein the sense strand comprises one or two inverted abasic residues.

16 . The RNAi agent of claim 1 , wherein the nucleobase sequence of the sense strand (5′→3′) is CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO:8).

17 . The RNAi agent of claim 1 , wherein all of the nucleotides are modified nucleotides.

18 . The RNAi agent of claim 1 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, or at the 5′ end of the nucleotide sequence.

19 . The RNAi agent of claim 1 , wherein the antisense strand has the nucleotide sequence (5′→3′) usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4)

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s represents a phosphorothioate linkage; and wherein all of the nucleotides on the sense strand are modified nucleotides.

20 . The RNAi agent of claim 1 , wherein the sense strand differs by 0 or 1 nucleotide from one of the following nucleotide sequences (5′→3′):

cguaagaaGfUfCfugauagauga (SEQ ID NO:9); or

cguaagaaGfuCfuGfauagauga (SEQ ID NO: 10);

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s represents a phosphorothioate linkage.

21 . The RNAi agent of claim 1 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, and at the 5′ end of the nucleotide sequence.

22 . The RNAi agent of claim 1 , wherein the sense strand of the RNAi agent is linked to a targeting ligand.

23 . The RNAi agent of claim 22 , wherein the targeting ligand has affinity for the asialoglycoprotein receptor.

24 . The RNAi agent of claim 23 , wherein the targeting ligand comprises N-acetyl-galactosamine.

25 . The RNAi agent of claim 22 , wherein the RNAi agent has the duplex structure that is AD06214 (SEQ ID NOs: 2 and 14) or AD06280 (SEQ ID NOs: 4 and 15).

26 . The RNAi agent of claim 22 , wherein the targeting ligand comprises:

27 . The RNAi agent of claim 1 , wherein the antisense strand consists of the modified nucleotide sequence of (5′→3′) usCfsasUfcUfaUfcAfgAfcUfuCfuUfaCfsg (SEQ ID NO:2), and the sense strand consists of the modified nucleotide sequence of (5′→3′) (NAG37)s(invAb)scguaagaaGfUfCfugauagaugas(invAb) (SEQ ID NO:14);

wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and

(NAG37)s comprises the following chemical structure:

28 . The RNAi agent of claim 1 , wherein the antisense strand consists of the modified nucleotide sequence of (5′→3′) usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4), and wherein the sense strand consists of the modified nucleotide sequence of (5′→3′) (NAG37)s (invAb) scguaagaaGfuCfuGfauagaugas (invAb) (SEQ ID NO:15);

wherein a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and

(NAG37)s comprises the following chemical structure:

29 . A composition comprising the RNAi agent of claim 28 , wherein the composition further comprises a pharmaceutically acceptable excipient.

30 . A composition comprising the RNAi agent of claim 1 , wherein the composition further comprises a pharmaceutically acceptable excipient.

31 . The composition of claim 30 , further comprising a second RNAi agent for inhibiting the expression of HSD17B13.

32 . The composition of claim 30 , further comprising one or more additional therapeutics.

33 . The composition of claim 32 , wherein the additional therapeutics comprises an anti-inflammatory agent.

34 . The RNAi agent of claim 1 , wherein the nucleobase sequence of the sense strand (5′→3′) is CGUAAGAAGUCUGAUAGAUGA (SEQ ID NO:8) and at least one of the nucleotides of the sense strand is a modified nucleotide or includes a modified internucleotide linkage.

35 . The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′):

usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4);

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s represents a phosphorothioate linkage; and wherein all of the nucleotides on the sense strand are modified nucleotides.

36 . The RNAi agent of claim 1 , wherein the sense strand differs by 0 or 1 nucleotide from the nucleotide sequences (5′→3′):

cguaagaaGfuCfuGfauagauga (SEQ ID NO:10);

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s represents a phosphorothioate linkage; and wherein all of the nucleotides on the antisense strand are modified nucleotides.

37 . The RNAi agent of claim 1 , wherein the antisense strand has the nucleotide sequence (5′→3′):

usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4),

wherein the sense strand differs by 0 or 1 nucleotide from the nucleotide sequences (5′→3′):

cguaagaaGfuCfuGfauagauga (SEQ ID NO:10), and

wherein a, c, g, and u represent 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s represents a phosphorothioate linkage; and wherein all of the nucleotides on the sense strand and the antisense strand are modified nucleotides.

38 . The RNAi agent of claim 1 , wherein the RNAi agent is in a free acid form.

39 . The RNAi agent of claim 1 , wherein the RNAi agent is in a sodium salt form.

40 . An RNAi agent comprising a chemical structure as follows with the antisense strand (5′→3′) SEQ ID NO:4 and the sense strand (5′→3′) SEQ ID NO:15:

41 . A composition comprising the RNAi agent of claim 40 , wherein the composition further comprises a pharmaceutically acceptable excipient.

42 . An RNAi agent comprising a chemical structure as follows with the antisense strand (5′→3′) SEQ ID NO:4 and the sense strand (5′→3′) SEQ ID NO: 15:

43 . A composition comprising the RNAi agent of claim 42 , wherein the composition further comprises a pharmaceutically acceptable excipient.

44 . An RNAi agent comprising 1) an antisense strand that comprises the structure of (5′→3′) usCfsasUfcUfaucagAfcUfuCfuUfaCfsg (SEQ ID NO:4), and 2) a sense strand that comprises the structure of (5′→3′) (NAG37)s(invAb)scguaagaaGfuCfuGfauagaugas(invAb) (SEQ ID NO:15), wherein: a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively; Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; s is a phosphorothioate linkage; (invAb) is an inverted abasic deoxyribose residue; and (NAG37)s comprises the following chemical structure:

45 . A composition comprising the RNAi agent of claim 44 , wherein the composition further comprises a pharmaceutically acceptable excipient.

Assignments (3)

Continuity (4)

References Cited (189)