HEPATITIS B IMMUNISATION REGIMEN AND COMPOSITIONS

1 . A method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in a human, comprising the steps of:

a) administering to the human a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO);

b) administering to the human a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc);

c) administering to the human a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); and

d) administering to the human a composition comprising a recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) and an adjuvant.

2 . A method according to claim 1 , wherein the steps b), c) and d) of the method are carried out sequentially, with step b) preceding step c) and step c) preceding step d).

3 . A method according to claim 2 , wherein step d) of the method is repeated.

4 . A method according to claim 1 in which step a) is repeated.

5 . A method according to claim 2 in which step a) is repeated prior to step b).

6 . A method according to any preceding claim in which the period of time between each step is 1 week, 2 weeks, 4 weeks, 6 weeks 8 weeks, 12 weeks, 6 months or 12 months, for example 4 weeks or 8 weeks.

7 . A method according to claim 1 , wherein step d) is carried out concomitantly with step b) and/or with step c).

8 . A method according to claim 7 in which step a) is repeated.

9 . A method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, comprising the steps of:

a) administering to the human a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO);

b) administering to the human i) a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc) and, concomitantly, ii) a composition comprising a recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) and an adjuvant; and

c) administering to the human i) a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc) and, concomitantly, a composition comprising a recombinant hepatitis B surface antigen (HBs), a recombinant hepatitis B virus core antigen (HBc) and an adjuvant.

10 . A method according to claim 10 in which step a) is repeated and precedes step b), and step b) precedes step c).

11 . A method according to any preceding claim, wherein the antisense oligonucleotide targeted to a HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC.

12 . A method according to any preceding claim, wherein the antisense oligonucleotide targeted to a HBV nucleic acid is a modified oligonucleotide “gapmer” consisting of 20 linked nucleosides in which each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, having the sequence GCAGAGGTGAAGCGAAGTGC consisting of a 5′ wing segment consisting of five linked nucleosides GCAGA each comprising a 2′-O-methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3′ wing segment consisting of five linked nucleosides AGTGC each comprising a 2′-O-methoxyethyl sugar.

13 . An immunogenic combination for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in a human, the immunogenic combination comprising:

a) a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO);

b) a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc);

c) a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); and

d) a composition comprising a recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant,

wherein the method comprises administering the compositions sequentially or concomitantly to the human.

14 . The immunogenic combination according to claim 13 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC.

15 . The immunogenic combination according to claim 13 or 14 wherein the antisense oligonucleotide targeted to a HBV nucleic acid is a modified oligonucleotide “gapmer” consisting of 20 linked nucleosides in which each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, having the sequence GCAGAGGTGAAGCGAAGTGC consisting of a 5′ wing segment consisting of five linked nucleosides GCAGA each comprising a 2′-O-methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3′ wing segment consisting of five linked nucleosides AGTGC each comprising a 2′-O-methoxyethyl sugar.

16 . An immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D infection (CHD) in a human, the immunogenic composition comprising an antisense oligonucleotide 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO) and a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs), a nucleic acid encoding a hepatitis B virus core antigen (HBc) and a nucleic acid encoding the human invariant chain (hIi) fused to the HBc, wherein the method comprises administration of the composition in a prime-boost regimen with at least one other immunogenic composition.

17 . The immunogenic composition for use according to claim 16 , further comprising one or more recombinant HBV protein antigens.

18 . An immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, the immunogenic composition comprising an antisense oligonucleotide 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO); and a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc) wherein the method comprises administration of the composition in a prime-boost regimen with at least one other immunogenic composition.

19 . The immunogenic composition for use according to claim 18 further comprising one or more recombinant HBV protein antigens.

20 . An immunogenic composition for use in a method of treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, the immunogenic composition comprising an antisense oligonucleotide 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO); and a recombinant hepatitis B surface antigen (HBs), a C-terminal truncated recombinant hepatitis B virus core antigen (HBc) and an adjuvant containing MPL and QS-21, wherein the method comprises administration of the composition in a prime-boost regimen with at least one other immunogenic composition.

21 . The immunogenic composition for use according to claim 20 in which the ratio of HBc to HBs in the composition is greater than 1.

22 . The immunogenic composition for use according to claim 21 in which the ratio of HBc to HBs in the composition is 4:1.

23 . The immunogenic composition for use according to any one of claims 20 to 22 further comprising one or more vectors encoding one or more HBV antigens.

24 . The immunogenic composition for use according to any of claims 16 to 23 , wherein the antisense oligonucleotide targeted to a HBV nucleic add has the sequence GCAGAGGTGAAGCGAAGTGC.

25 . The immunogenic composition for use according to any of claims 16 to 24 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid is a modified oligonucleotide “gapmer” consisting of 20 linked nucleosides in which each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, having the sequence GCAGAGGTGAAGCGAAGTGC consisting of a 5′ wing segment consisting of five linked nucleosides GCAGA each comprising a 2′-O-methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3′ wing segment consisting of five linked nucleosides AGTGC each comprising a 2′-O-methoxyethyl sugar.

26 . The use of an immunogenic composition in the manufacture of a medicament for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, the immunogenic composition comprising an antisense 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO) and a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs), a nucleic acid encoding a hepatitis B virus core antigen (HBc) and a nucleic acid encoding the human invariant chain (hIi) fused to the nucleic acid encoding HBc, wherein the method of treating chronic hepatitis B infection and/or CHD infection comprises administration of the composition in a prime-boost regimen with at least one other immunogenic composition.

27 . The use of an immunogenic composition in the manufacture of a medicament for treating chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, the immunogenic composition comprising an antisense 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO) and a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc) wherein the method of treating chronic hepatitis B infection and/or CHD infection comprises administration of the composition in a prime-boost regimen with at least one other immunogenic composition.

28 . The use of an immunogenic combination in the manufacture of a medicament for the treatment of chronic hepatitis B infection (CHB) and/or chronic hepatitis D (CHD) infection in a human, the immunogenic combination comprising:

a) an antisense oligonucleotide 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO);

b) a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc);

c) a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic add encoding a hepatitis B virus core antigen (HBc); and

d) a composition comprising a recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant,

wherein the method of treating chronic hepatitis B infection and/or CHD infection comprises administering the compositions sequentially or concomitantly to the human.

29 . The use of an immunogenic composition in the manufacture of a medicament according to any of claims 26 to 28 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC.

30 . The use of an immunogenic composition in the manufacture of a medicament according to any of claims 26 to 29 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid is a modified oligonucleotide “gapmer” consisting of 20 linked nucleosides in which each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, having the sequence GCAGAGGTGAAGCGAAGTGC consisting of a 5′ wing segment consisting of five linked nucleosides GCAGA each comprising a 2′-O-methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3′ wing segment consisting of five linked nucleosides AGTGC each comprising a 2′-O-methoxyethyl sugar.

31 . An immunogenic combination comprising:

a) a composition comprising an antisense oligonucleotide (ASO) 10 to 30 nucleosides in length, targeted to a HBV nucleic acid (an HBV ASO);

b) a composition comprising a replication-defective chimpanzee adenoviral (ChAd) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc);

c) a composition comprising a Modified Vaccinia Virus Ankara (MVA) vector comprising a polynucleotide encoding a hepatitis B surface antigen (HBs) and a nucleic acid encoding a hepatitis B virus core antigen (HBc); and

d) a composition comprising a recombinant hepatitis B surface antigen (HBs), recombinant hepatitis B virus core antigen (HBc) and an adjuvant.

32 . The immunogenic combination according to claim 31 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid has the sequence GCAGAGGTGAAGCGAAGTGC.

33 . The immunogenic combination according to claim 31 or 32 , wherein the antisense oligonucleotide targeted to a HBV nucleic acid is a modified oligonucleotide “gapmer” consisting of 20 linked nucleosides in which each internucleoside linkage is a phosphorothioate linkage and each cytosine is a 5-methylcytosine, having the sequence GCAGAGGTGAAGCGAAGTGC consisting of a 5′ wing segment consisting of five linked nucleosides GCAGA each comprising a 2′-O-methoxyethyl sugar, followed by ten linked deoxynucleosides GGTGAAGCGA and a 3′ wing segment consisting of five linked nucleosides AGTGC each comprising a 2′-O-methoxyethyl sugar.