MOLECULAR ELECTRONIC SENSORS FOR DETECTING SARS-COV-2 VIRUS
A molecular electronics sensor capable of performing genetic analysis is described. In various embodiments, the sensor comprises spaced-apart electrodes, a bridge molecule coupled to the electrodes, and an oligonucleotide hybridization probe conjugated to the bridge molecule. The hybridization probe may comprise an oligonucleotide sequence complementary to a segment of a pathogen genome to be detected. In various aspects, a plurality of such sensors are disposed as an array of pixels on a CMOS chip. Sensors herein can be configured to detect a segment of SARS-CoV-2 genome in a bio-sample.
1 . A sensor device comprising:
a plurality of sensor pixels configured in an array on a semiconductor chip, the plurality of sensor pixels comprising at least a first subset of sensor pixels and a second subset of sensor pixels;
wherein each sensor pixel in the plurality of sensor pixels comprises a molecular electronics sensor further comprising: a first electrode; a second electrode spaced-apart from the first electrode by a nanogap; a bridge molecule having a first end and a second end, the first end coupled to the first electrode and the second end coupled to the second electrode; and a hybridization probe having an oligonucleotide sequence conjugated to the bridge molecule;
wherein each molecular electronics sensor in the first subset of sensor pixels includes a first hybridization probe comprising a first oligonucleotide sequence selected from SEQ ID NO:252
SEQ ID NO: 252
(GCAATGGTACGGTACTTCC[[G]]GGATGCGGAAACTGGCTAATTGGTG
AGGCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTT GCTAA),
SEQ ID NO: 254
(CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGA
CA),
or a hybridization probe having a sequence at least 95% sequence identity to one of the preceding; and
wherein each molecular electronics sensor in the second subset of sensor pixels includes a second hybridization probe comprising a second oligonucleotide sequence at least partially complementary to the first hybridization probe.
2 . The sensor device of claim 1 , wherein the plurality of sensor pixels further comprises a third subset of sensor pixels, and wherein each molecular electronics sensor in the third subset of sensor pixels includes a third hybridization probe comprising a third oligonucleotide sequence.
3 . The sensor device of claim 1 , wherein the plurality of sensor pixels further comprises a third subset of sensor pixels and a fourth subset of sensor pixels, wherein each molecular electronics sensor in the third subset of sensor pixels includes a third hybridization probe comprising a third oligonucleotide sequence, and wherein each molecular electronics sensor in the fourth subset of sensor pixels includes a fourth hybridization probe comprising a fourth oligonucleotide sequence.
4 . The sensor device of claim 3 , wherein the plurality of sensor pixels further comprises a third subset of sensor pixels, a fourth subset of sensor pixels, and a fifth set of sensor pixels, wherein each molecular electronics sensor in the third subset of sensor pixels includes a third hybridization probe comprising a third oligonucleotide sequence; wherein each molecular electronics sensor in the fourth subset of sensor pixels includes a fourth hybridization probe comprising a fourth oligonucleotide sequence; and wherein each molecular electronics sensor in the fifth subset of sensor pixels includes a fifth hybridization probe comprising a fifth oligonucleotide sequence.
5 . The sensor device of claim 1 , wherein each bridge molecule in the plurality of sensor pixels comprises a peptide or polypeptide.
6 . The sensor device of claim 3 , wherein each bridge molecule in the plurality of sensor pixels comprises a peptide or polypeptide.
7 . The sensor device of claim 1 , wherein each bridge molecule in the plurality of sensor pixels comprises a nucleic acid.
8 . The sensor device of claim 7 , wherein the nucleic acid is double stranded.
9 . The sensor device of claim 3 , wherein each bridge molecule in the plurality of sensor pixels comprises a nucleic acid.
10 . The sensor device of claim 9 , wherein the nucleic acid is double stranded.
11 . The sensor device of claim 1 , wherein:
each molecular electronics sensor in the first subset of sensor pixels further comprises a first decoding probe bonded to either the bridge molecule or the first hybridization probe in the molecular electronics sensor;
each molecular electronics sensor in the second subset of sensor pixels further comprises a second decoding probe bonded to either the bridge molecule or the second hybridization probe in the molecular electronics sensor;
each molecular electronics sensor in the third subset of sensor pixels further comprises a third decoding probe bonded to either the bridge molecule or the third hybridization probe in the molecular electronics sensor;
each molecular electronics sensor in the fourth subset of sensor pixels further comprises a fourth decoding probe bonded to either the bridge molecule or the fourth hybridization probe in the molecular electronics sensor; and
each molecular electronics sensor in the fifth subset of sensor pixels further comprises a fifth decoding probe bonded to either the bridge molecule or the fifth hybridization probe in the molecular electronics sensor.
12 . The sensor device of claim 1 , wherein the second hybridization probe comprises a second oligonucleotide sequence selected from
(SEQ ID NO: 253)
GACCGCCCCAGCCT,
(SEQ ID NO: 255)
CCCGCAATTACCTGT ,
or a hybridization probe having a sequence at least 90% sequence identity to one of the preceding.
13 . The sensor device of claim 1 , wherein the device is configured as a portable wastewater monitor for the detection of SARS-CoV-2.
14 . The sensor device of claim 1 , wherein the device is configured as a point of care breath analyzer for the detection of SARS-CoV-2.
15 . A method of detecting a target oligonucleotide sequence in a bio-sample comprising:
providing a sensor device comprising a plurality of sensor pixels configured in an array on a semiconductor chip, the plurality of sensor pixels comprising at least a first subset of sensor pixels; wherein each sensor pixel in the plurality of sensor pixels comprises a molecular electronics sensor further comprising: a first electrode; a second electrode spaced-apart from the first electrode by a nanogap; a bridge molecule having a first end and a second end, the first end coupled to the first electrode and the second end coupled to the second electrode; a hybridization probe having an oligonucleotide sequence conjugated to the bridge molecule; and a second hybridization probe comprising a second oligonucleotide sequence at least partially complementary to the first hybridization probe;
wherein each molecular electronics sensor in the first subset of sensor pixels includes a first hybridization probe comprising a first oligonucleotide sequence capable of hybridizing to the target oligonucleotide sequence;
initiating at least one of a voltage or a current through each sensor pixel in the plurality of sensor pixels;
exposing the plurality of sensor pixels to the bio-sample; and
measuring electrical signals from the first subset of sensor pixels as the target oligonucleotide sequence and the first hybridization probe engage in hybridization, wherein the electrical signals provide a signature indicating the target oligonucleotide sequence is present in the bio-sample.
16 . The method of claim 15 , further comprising amplifying at least the target oligonucleotide sequence prior to exposure of the plurality of sensor pixels to the bio-sample.
17 . The method of claim 15 , wherein the first hybridization probe oligonucleotide sequence is selected from SEQ ID NO:252
SEQ ID NO: 252
(GCAATGGTACGGTACTTCC[[G]]GGATGCGGAAACTGGCTAATTGGTG
AGGCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTT GCTAA),
SEQ ID NO: 254
(CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGA
CA),
or a hybridization probe having a sequence at least 95% sequence identity to one of the preceding.
18 . The method of claim 15 , wherein the second hybridization probe oligonucleotide sequence is selected from
(SEQ ID NO: 253)
GACCGCCCCAGCCT,
(SEQ ID NO: 255)
CCCGCAATTACCTGT ,
or a hybridization probe having a sequence at least 90% sequence identity to one of the preceding.
19 . The method of claim 15 , used to monitor water for the detection of SARS-CoV-2.
20 . The method of claim 15 , used to analyze or monitor the breath of a subject for the detection of SARS-CoV-2 at a desired location.