Alpha-1 antitrypsin (AAT) RNAi agents, compositions including AAT RNAi agents, and methods of use

1. An RNAi agent for inhibiting the expression of an alpha-1 antitrypsin (AAT) gene comprising a sense strand and an antisense strand,

wherein nucleotides 2-18 of the antisense strand comprise nucleotides 2-18 of

(SEQ ID NO: 83)

NGUUAAACAUGCCUAAACN,

wherein the sense strand is at least substantially complementary to the antisense strand; and

wherein the antisense strand comprises (i) 2 or 3 phosphorothioate linkages at its 5′ end,

(ii) at least 8 nucleotides selected from 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, (iii) at least 11 nucleotides selected from 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, or (iv) any combination thereof.

2. The RNAi agent of claim 1 , wherein the antisense strand comprises a nucleotide sequence selected from (5′→3′):

(i)

(SEQ ID NO: 794)

UGUUAAACAUGCCUAAACGUU;

(ii)

(SEQ ID NO: 839)

UGUUAAACAUGCCUAAACGCUU;

(iii)

(SEQ ID NO: 800)

UGUUAAACAUGCCUAAACGCG;

and

(iv)

(SEQ ID NO: 801)

UGUUAAACAUGCCUAAACGCU.

3. The RNAi agent of claim 1 , wherein the sense strand comprises a nucleotide sequence selected from (5′→3′):

(i)

(SEQ ID NO: 866)

AGCGUUUAGGCAUGUUUAACA;

(ii)

(SEQ ID NO: 857)

CGUUUAGGCAUGUUUAACAUU;

(iii)

(SEQ ID NO: 885)

GCGUUUAGGCAUGUUUAACAUU;

and,

(iv)

(SEQ ID NO: 864)

CGCGUUUAGGCAUGUUUAACA.

4. The RNAi agent of claim 1 , wherein the RNAi agent comprises a targeting group.

5. The RNAi agent of claim 4 , wherein the targeting group is conjugated to the 5′-terminal end of the sense strand.

6. The RNAi agent of claim 4 , wherein the targeting group comprises an asialoglycoprotein receptor ligand.

7. The RNAi agent of claim 6 , wherein the asialoglycoprotein receptor ligand comprises an N-acetylgalactosamine trimer.

8. The RNAi agent of claim 1 , wherein the RNAi agent further comprises one or more targeting groups, wherein the targeting group comprises a structure of: (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), or (NAG39)s.

9. The RNAi agent of claim 8 , wherein the targeting group is (NAG37)s, and (NAG37)s has the following chemical structure:

10. The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence (5′→3′) usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage.

11. The RNAi agent of claim 10 , wherein the sense strand comprises the sequence (5′→3′) agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage;

wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and

wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.

12. The RNAi agent of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage.

13. The RNAi agent of claim 12 , wherein the sense strand comprises the sequence (5′→3′) cguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1276), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage;

wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and

wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.

14. The RNAi agent of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage.

15. The RNAi agent of claim 14 , wherein the sense strand comprises the sequence (5′→3′) gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage;

wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and

wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.

16. The RNAi agent of claim 1 , wherein the antisense strand of the RNAi agent comprises the sequence (5′→3′) usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, and 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage.

17. The RNAi agent of claim 16 , wherein the sense strand comprises the sequence (5′→3′) cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), wherein:

a, c, g, and u are 2′-O-methyl adenosine, 2′-O-methyl cytidine, 2′-O-methyl guanosine, or 2′-O-methyl uridine, respectively;

Af, Cf, Gf, and Uf are 2′-fluoro adenosine, 2′-fluoro cytidine, 2′-fluoro guanosine, and 2′-fluoro uridine, respectively; and

s is a phosphorothioate linkage;

wherein optionally present on the sense strand is one or two inverted abasic deoxyribose residues (invAb) and/or one, two, three, or four phosphorothioate internucleoside linkages; and

wherein optionally linked to the 5′ terminal end of the sense strand is a targeting ligand that comprises N-acetyl-galactosamine.

18. The RNAi agent of claim 1 , wherein the antisense strand is 21 or 22 nucleotides in length.

19. The RNAi agent of claim 1 , wherein each nucleotide of the antisense strand is a modified nucleotide.

20. A composition comprising the RNAi agent of claim 1 and at least one pharmaceutically acceptable excipient.

21. The composition of claim 20 , wherein the composition is formulated for administration by subcutaneous injection.