RNAi Agents And Compositions for Inhibiting Expression of Apolipoprotein C-III (APOC3)
The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents, capable of inhibiting Apolipoprotein C-III (also called APOC3, apoC-III, APOC-III, and APO C-III) gene expression, and compositions that include APOC3 RNAi agents. The APOC3 RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that include N-acetyl-galactosamine, to facilitate the delivery to cells, including to hepatocytes. Pharmaceutical compositions that include one or more APOC3 RNAi agents, optionally with one or more additional therapeutics, are also described. Delivery of the APOC3 RNAi agents in vivo provides for inhibition of APOC3 gene expression, and can result in lower triglycerides and/or cholesterol levels in the subject. The APOC3 RNAi agents can be used in methods of treatment of APOC3-related diseases and disorders, including hypertriglyceridemia, cardiovascular disease, and other metabolic-related disorders and diseases.
1 . An RNAi agent for inhibiting expression of an APOC3 gene, comprising:
an antisense strand comprising at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sequences provided in Table 2, Table 3, or Table 4; and
a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand.
2 . The RNAi agent of claim 1 , wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2, Table 3, or Table 4.
3 . The RNAi agent of claim 1 , wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides differing by 0 or 1 nucleotides from any one of the sense strand sequences provided in Table 2, Table 3, or Table 5, and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
4 . The RNAi agent of claim 1 , wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage.
5 . The RNAi agent of claim 1 , wherein all or substantially all of the nucleotides of the sense and/or antisense strand of the RNAi agent are modified nucleotides.
6 . The RNAi agent of claim 4 , wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate deoxyribonucleotide, cyclopropyl phosphonate deoxyribonucleotide, and 3′-O-methyl nucleotide.
7 . The RNAi agent of claim 5 , wherein all or substantially all of the modified nucleotides are either 2′-O-methyl nucleotides or 2′-fluoro nucleotides.
8 . The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 3 or Table 4.
9 . The RNAi agent of claim 8 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified antisense strand sequences provided in Table 4.
10 . The RNAi agent of claim 1 , wherein the sense strand comprises the nucleotide sequence of any one of the modified sense strand sequences provided in Table 3 or Table 5.
11 . The RNAi agent of claim 1 , wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 4 and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Table 5.
12 . The RNAi agent of claim 1 , wherein the RNAi agent is linked to a targeting ligand.
13 . The RNAi agent of claim 12 , wherein the targeting ligand comprises N-acetyl-galactosamine.
14 . The RNAi agent of claim 12 , wherein the targeting ligand comprises a structure selected from the group consisting of: (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.
15 . The RNAi agent of claim 14 , wherein the targeting ligand comprises the structure of (NAG37) or (NAG37)s.
16 . The RNAi agent of claim 12 , wherein the targeting ligand is conjugated to the sense strand.
17 . The RNAi agent of claim 16 , wherein the targeting ligand is conjugated to the 5′ terminal end of the sense strand.
18 . The RNAi agent of claim 1 , wherein the sense strand is between 18 and 30 nucleotides in length, and the antisense strand is between 18 and 30 nucleotides in length.
19 . The RNAi agent of claim 18 , wherein the sense strand and the antisense strand are each between 18 and 27 nucleotides in length.
20 . The RNAi agent of claim 19 , wherein the sense strand and the antisense strand are each between 18 and 24 nucleotides in length.
21 . The RNAi agent of claim 20 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
22 . The RNAi agent of claim 21 , wherein the RNAi agent has two blunt ends.
23 . The RNAi agent of claim 1 , wherein the sense strand comprises one or two terminal caps.
24 . The RNAi agent of claim 23 , wherein the sense strand comprises one or two inverted abasic residues.
25 . The RNAi agent of claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 3 or Table 6.
26 . The RNAi agent of claim 1 comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 3)
UCACUGAGAAUACUGUCCCUC;
(SEQ ID NO: 5)
UCACUGAGAAUACUGUCCCGU;
(SEQ ID NO: 8)
UUCUUGUCCAGCUUUAUUGGC;
(SEQ ID NO: 10)
AGAAUACUGUCCCUUUUAGGG;
(SEQ ID NO: 12)
AGAAUACUGUCCCUUUUAAGC;
or
(SEQ ID NO: 14)
UGAGAAUACUGUCCCUUUGCC.
27 . The RNAi agent of claim 26 , wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 16)
GAGGGACAGUAUUCUCAGUIA;
(SEQ ID NO: 18)
ACGGGACAGUAUUCUCAGUIA;
(SEQ ID NO: 21)
GAGGGACAGUAUUCUCAGUGA;
(SEQ ID NO: 23)
GCCAAUAAAGCUGGACAAGAA;
(SEQ ID NO: 25)
GCCAAUAAAICUGGACAAGAA;
(SEQ ID NO: 27)
CCCUAAAAGGGACAGUAUUCU;
(SEQ ID NO: 29)
GCUUAAAAGGGACAGUAUUCU;
or
(SEQ ID NO: 31)
GGCAAAGGGACAGUAUUCUCA;
wherein I represents an inosine nucleotide.
28 . The RNAi agent of claim 26 , wherein all or substantially all of the nucleotides on both the antisense strand and the sense strand are modified nucleotides.
29 . The RNAi agent of claim 26 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end and at the 5′ end of the nucleotide sequence.
30 . The RNAi agent of claim 26 , wherein the sense strand of the RNAi agent is linked to a targeting ligand.
31 . The RNAi agent of claim 30 , wherein the targeting ligand has affinity for the asialoglycoprotein receptor.
32 . The RNAi agent of claim 31 , wherein the targeting ligand comprises N-acetyl-galactosamine.
33 . The RNAi agent of claim 1 , comprising an antisense strand that comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 2)
usCfsasCfuGfagaauAfcUfgUfcCfcUfsc;
(SEQ ID NO: 4)
usCfsasCfuGfagaauAfcUfgUfcCfcGfsu;
(SEQ ID NO: 6)
usCfsascugagaauAfcUfgUfcCfcUfsc;
(SEQ ID NO: 7)
usUfscsUfuGfuCfcAfgCfuUfuAfuUfgGfsc;
(SEQ ID NO: 9)
asGfsasAfuAfcUfgUfcCfcUfuUfuAfgGfsg;
(SEQ ID NO: 11)
asGfsasAfuAfcUfgUfcCfcUfuUfuAfaGfsc;
and
(SEQ ID NO: 13)
usGfsasGfaAfuAfcUfgUfcCfcUfuUfgcsc;
wherein a, c, g, and u represent 2′-O-methyl adenosine, cytidine, guanosine, or uridine, respectively; Af, Cf, Gf, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, or uridine, respectively; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
34 . The RNAi agent of claim 33 , wherein the sense strand comprises, consists of, or consists essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotides from one of the following nucleotide sequences (5′→3′):
(SEQ ID NO: 15)
gagggacaGfUfAfuucucaguia;
(SEQ ID NO: 17)
acgggacaGfUfAfuucucaguia;
(SEQ ID NO: 19)
gagggacaGfuAfuUfcucaguia;
(SEQ ID NO: 20)
gagggacaGfUfAfuucucaguga;
(SEQ ID NO: 22)
gccaauaaAfGfCfuggacaagaa;
(SEQ ID NO: 24)
gccaauaaAfIfCfuggacaagaa;
(SEQ ID NO: 26)
cccuaaaaGfGfGfacaguauucu;
(SEQ ID NO: 28)
gcuuaaaaGfGfGfacaguauucu;
and
(SEQ ID NO: 30)
ggcaaaggGfAfCfaguauucuca;
wherein a, c, g, i, and u represent 2′-O-methyl adenosine, cytidine, guanosine, inosine, or uridine, respectively; Af, Cf, Gf, If, and Uf represent 2′-fluoro adenosine, cytidine, guanosine, inosine or uridine, respectively; and s represents a phosphorothioate linkage.
35 . The RNAi agent of claim 33 , wherein the sense strand further includes an inverted abasic residue at the 3′ terminal end and/or at the 5′ end of the nucleotide sequence.
36 . The RNAi agent of claim 33 , wherein the sense strand of the RNAi agent is linked to a targeting ligand.
37 . The RNAi agent of claim 36 , wherein the targeting ligand has affinity for the asialoglycoprotein receptor.
38 . The RNAi agent of claim 37 , wherein the targeting ligand comprises N-acetyl-galactosamine.
39 . The RNAi agent of claim 1 , wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05251 (SEQ ID NOs: 2 and 501); AD05876 (SEQ ID NOs: 4 and 572); AD05769 (SEQ ID NOs: 6 and 557); AD05169 (SEQ ID NOs: 2 and 482); AD05220 (SEQ ID NOs: 7 and 494); AD05547 (SEQ ID NOs: 7 and 545); AD05299 (SEQ ID NOs: 9 and 521); AD05223 (SEQ ID NOs: 11 and 497); and AD05171 (SEQ ID NOs: 13 and 483).
40 . The RNAi agent of claim 39 , wherein the RNAi agent has the duplex structure selected from the group consisting of: AD05251 (SEQ ID NOs: 2 and 501) and AD05876 (SEQ ID NOs: 4 and 572).
41 . A composition comprising the RNAi agent of claim 1 , wherein the composition comprises a pharmaceutically acceptable excipient.
42 . The composition of claim 41 , wherein the RNAi agent is conjugated to a targeting ligand.
43 . The composition of claim 42 , wherein the targeting ligand comprises n-acetyl-galactosamine.
44 . The composition of claim 43 , wherein the targeting ligand is selected from the targeting ligands in Table 7.
45 . The composition of claim 41 , wherein the composition further comprises a second RNAi agent for inhibiting the expression of APOC3.
46 . The composition of claim 41 , wherein the composition further comprises one or more additional therapeutics.
47 . A method for inhibiting expression of an APOC3 gene in a cell, the method comprising introducing into a cell an effective amount of the composition of claim 41 .
48 . The method of claim 47 , wherein the cell is within a subject.
49 . The method of claim 48 , wherein the subject is a human subject.
50 . The method of claim 47 , wherein the APOC3 gene expression is inhibited by at least about 30%.
51 . A method of treating an APOC3-related disease or disorder, the method comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 41 .
52 . The method of claim 51 , wherein the disease is a cardiometabolic disease.
53 . The method of claim 52 , wherein disease hypertriglyceridemia, obesity, hyperlipidenia, abnormal lipid and/or cholesterol metabolism, atherosclerosis, cardiovascular disease, coronary artery disease, hypertriglyceridemia induced pancreatitis, metabolic syndrome, type II diabetes mellitus, familial chylomicronemia syndrome, or familial partial lipodystrophy.
54 . The method of claim 51 , wherein the RNAi agent is administered at a dose of about 0.05 mg/kg to about 5.0 mg/kg of body weight of the human subject.
55 . The method of claim 51 , wherein the RNAi agent is administered in two or more doses.
56 . The method of claim 51 , wherein the dose is administered by subcutaneous injection.
57 . A method of lowering triglyceride levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41 .
58 . A method of lowering cholesterol levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41 .
59 . A method of lowering low density lipoprotein (LDL) levels in a subject, the method comprising administering to the subject an effective amount of a composition of claim 41 .