EXTRACELLULAR VESICLE-ASO CONSTRUCTS TARGETING CEBP/BETA
The present disclosure relates to extracellular vesicles, e.g., exosomes, comprising an antisense oligonucleotide (ASO), wherein the ASO comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within a CEBP/transcript. Also provided herein are methods for producing the exosomes and methods for using the exosomes to treat and/or prevent diseases or disorders.
1 . An extracellular vesicle comprising an antisense oligonucleotide (ASO) which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within a CEBP/β transcript (SEQ ID NO: 11 or SEQ ID NO: 13).
2 . The extracellular vesicle of claim 1 , wherein the ASO is not TGGATTTAAAGGCAGGCGGC (SEQ ID NO: 90).
3 - 9 . (canceled)
10 . The extracellular vesicle of claim 1 , wherein the ASO is a gapmer, a mixmer, or a totalmer.
11 . The extracellular vesicle of claim 1 , wherein the ASO comprises one or more nucleoside analogs.
12 . (canceled)
13 . The extracellular vesicle of claim 11 , wherein one or more of the nucleoside analogs is a sugar modified nucleoside.
14 - 21 . (canceled)
22 . The extracellular vesicle of claim 1 , wherein the contiguous nucleotide sequence comprises a nucleotide sequence complementary to a sequence selected from the sequences in FIG. 1 : or wherein the ASO comprises a nucleotide sequence selected from SEO ID NOs: 194-296, with one or two mismatches.
23 - 24 . (canceled)
25 . The extracellular vesicle of claim 1 , wherein the ASO has a design selected from the group consisting of the designs in FIG. 1 , wherein the upper letter is a sugar modified nucleoside and the lower case letter is DNA.
26 - 30 . (canceled)
31 . The extracellular vesicle of claim 1 , which further comprises
(i) an anchoring moiety, wherein the ASO is linked to the anchoring moiety;
(ii) an exogenous targeting moiety: or
(iii) both (i) and (ii).
32 - 74 . (canceled)
75 . The extracellular vesicle of claim 31 , wherein the anchoring moiety comprises sterol, GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof.
76 - 77 . (canceled)
78 . The extracellular vesicle of claim 31 , wherein the ASO is linked to the anchoring moiety by a linker.
79 . (canceled)
80 . The extracellular vesicle of claim 78 , wherein the linker;
(i) is a polypeptide;
(ii) is a non-polypeptide moiety;
(iii) comprises ethylene glycol;
(iv) comprises acrylic phosphoramidite (e.g., Acrydite™), adenylation, azide (NS Ester), digoxigenin (NHS Ester), cholesterol-TEG, I-LINKER™, an amino modifier (e.g., amino modifier C6, amino modifier C12, amino modifier C6 dT, or Uni-Link™ amino modifier), alkyne, 5′ Hexynyl, 5-Octadiynyl dU, biotinylation (e.g., biotin, biotin (Azide), biotin dT, biotin-TEG, dual biotin, PC biotin, or desthiobiotin), thiol modification (thiol modifier C3 S—S, dithiol or thiol modifier C6 S—S), or any combination thereof;
(v) comprises valine-alanine-p-aminobenzylcarbamate or valine-citrulline-p-aminobenzylcarbamate; or
(vi) any combination thereof.
81 - 87 . (canceled)
88 . The extracellular vesicle of claim 1 , wherein the EV is an exosome.
89 . An antisense oligonucleotide (ASO) comprising comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within a CEBP/β transcript (SEQ ID NO: 11 or SEQ ID NO: 13).
90 - 112 . (canceled)
113 . A conjugate comprising the ASO of claim 89 , wherein the ASO is covalently attached to at least one non-nucleotide or non-polynucleotide moiety.
114 - 115 . (canceled)
116 . A pharmaceutical composition comprising the extracellular vesicle of claim 1 , and a pharmaceutically acceptable diluent, carrier, salt, or adjuvant.
117 - 122 . (canceled)
123 . A kit comprising the extracellular vesicle of claim 1 , and instructions for use.
124 . (canceled)
125 . A method of inhibiting or reducing CEBP/β protein expression in a cell, comprising administering the extracellular vesicle of claim 1 to the cell expressing CEBP/β protein, wherein the CEBP/β protein expression in the cell is inhibited or reduced after the administration.
126 . A method of treating a cancer in a subject in need thereof, comprising administering an effective amount of the extracellular vesicle of claim 1 to the subject.
127 - 128 . (canceled)
129 . A method of treating a disease or disorder in a subject in need thereof, comprising administering an effective amount of the extracellular vesicle of claim 1 to the subject, wherein the disease or disorder is selected from a fibrosis, an inflammation, a neurodegenerative disease, a metabolic disorder/CVD, and any combination thereof.
130 - 138 . (canceled)
139 . A method of activating meningeal macrophages, inducing M1 polarization of meningeal macrophages, or inducing meningeal macrophage infiltration of a tumor in a subject in need thereof, comprising administering the extracellular vesicle of claim 1 to the subject.
140 - 142 . (canceled)