COMPOSITIONS AND METHODS FOR NON-TOXIC CONDITIONING
The invention features compositions and methods for conditioning a patient (e.g., to facilitate transplantation and/or engraftment). The invention provides a base editing strategy targeting cell surface proteins that is useful for conditioning. In one aspect, the invention provides methods of producing a hematopoietic stem cell or progenitor thereof for the treatment of a hemoglobinopathy, hematologic cancer, or myeloproliferative disease.
1 . A method of producing a hematopoietic stem cell or progenitor thereof for the treatment of a hemoglobinopathy, hematologic cancer, or myeloproliferative disease, the method comprising:
(a) expressing in the hematopoietic stem cell or progenitor thereof a nucleobase editor polypeptide, wherein the nucleobase editor polypeptide comprises a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase; and
(b) contacting the hematopoietic stem cell or progenitor thereof with a guide RNA that targets a nucleic acid molecule encoding a cell surface protein selected from the group consisting of CD117, CXCR4, CD135, CD90, CD45, and CD34, and introducing a mutation in the cell surface protein.
2 . (canceled)
3 . The method of claim 1 ,
wherein the hemoglobinopathy is selected from the group consisting of sickle cell anemia, thalassemia, Fanconi anemia, aplastic anemia, and Wiskott-Aldrich syndrome;
wherein the hematologic cancer is selected from the group consisting of acute myeloid leukemia, acute lymphoid leukemia, chronic myeloid leukemia, chronic lymphoid leukemia, multiple myeloma, diffuse large B-cell lymphoma, and non-Hodgkin's lymphoma; and
wherein the myeloproliferative disease is a myelodysplastic syndrome.
4 - 5 . (canceled)
6 . A method of identifying a mutation that alters antibody binding to a cell surface protein, the method comprising
(a) expressing in a cell comprising a cell surface protein a nucleobase editor polypeptide, wherein the nucleobase editor polypeptide comprises a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase;
(b) contacting the cell with a guide RNA capable of targeting a nucleic acid molecule encoding the cell surface protein and introducing a mutation in the cell surface protein; and
(c) contacting the cell with an antibody that specifically binds a wild-type cell surface protein, but that exhibits reduced binding to the cell surface protein comprising the mutation, thereby identifying a mutation that alters antibody binding to the cell surface protein.
7 . (canceled)
8 . The method of claim 1 , wherein the cell surface protein is selected from the group consisting of CD117, CXCR4, CD135, CD90, CD45, and CD34.
9 . (canceled)
10 . The method of claim 1 , wherein the method further comprises contacting the cell with one or more additional guide RNAs that target a cell surface protein selected from the group consisting of CXCR4, CD135, CD90, CD45, and CD34.
11 - 13 . (canceled)
14 . A method of identifying a mutation that alters antibody binding to a cell surface protein, the method comprising
(a) expressing in a hematopoietic stem cell or progenitor thereof a nucleobase editor polypeptide, wherein the nucleobase editor polypeptide comprises a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase;
(b) contacting the cell with a guide RNA capable of targeting a nucleic acid molecule encoding a cell surface protein selected from the group consisting of CD117, CXCR4, CD135, CD90, CD45, CD34, and introducing a mutation in the cell surface protein; and
(c) contacting the cell with an antibody that specifically binds a wild-type cell surface protein, but that exhibits reduced binding to the cell surface protein comprising a mutation, thereby identifying a mutation that alters antibody binding to the cell surface protein.
15 . A method of base editing a gene encoding a cell surface protein expressed by a hematopoietic stem cell or a progenitor thereof, the method comprising
(a) expressing in a hematopoietic stem cell or a progenitor thereof comprising a CD117 protein a nucleobase editor polypeptide, wherein the nucleobase editor polypeptide comprises a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase; and
(b) contacting the cell with a guide RNA capable of targeting a nucleic acid molecule encoding the CD117 protein, thereby base editing the gene encoding the cell surface protein.
16 . The method of claim 1 , wherein the deaminase domain is an adenosine deaminase or a cytidine deaminase.
17 . The method of claim 16 , wherein the adenosine deaminase is a TadA*8 variant.
18 . The method of claim 17 , wherein the adenosine deaminase is TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, TadA*8.7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15, TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or TadA*8.24.
19 - 22 . (canceled)
23 . A method of conditioning a subject concurrent with or subsequent to a hematopoietic stem cell transplant (HSCT), the method comprising
(a) expressing in an isolated hematopoietic stem cell of the subject or of a donor a nucleobase editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase;
(b) contacting the hematopoietic stem cell with a guide RNA capable of targeting a nucleic acid molecule encoding a cell surface protein selected from the group consisting of CD117, CXCR4, CD135, CD90, CD45, and CD34, thereby introducing a mutation in the cell surface protein and generating an edited hematopoietic stem cell;
(c) administering the edited hematopoietic stem cell to the subject; and
(d) administering to the subject an antibody, antibody drug conjugate, or chimeric antigen receptor expressing T cell (CAR-T) that selectively binds a wild-type version of the cell surface protein, wherein the administering of step (d) is concurrent with or subsequent to step (c).
24 . A method of conditioning a subject concurrent with or subsequent to a hematopoietic stem cell transplant (HSCT), the method comprising
(a) expressing in a hematopoietic stem cell of the subject a nucleobase editor polypeptide comprising a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase;
(b) contacting the hematopoietic stem cell with a guide RNA capable of targeting a nucleic acid molecule encoding a CD117 protein, thereby introducing a mutation in the CD117 protein and generating an edited hematopoietic stem cell;
(c) administering the edited hematopoietic stem cell to the subject; and
(d) administering to the subject an antibody, antibody drug conjugate, or chimeric antigen receptor expressing T cell (CAR-T) that selectively binds a wild-type version of CD117, wherein the administering of step (d) is concurrent with or subsequent to step (c).
25 . The method of claim 23 , wherein the deaminase domain is an adenosine deaminase or a cytidine deaminase.
26 - 33 . (canceled)
34 . The method of claim 1 , wherein the CD117 cell surface protein comprising the mutation is capable of binding Stem Cell Factor (SCF) or is capable of SCF signaling.
35 - 36 . (canceled)
37 . The method of claim 36 , wherein the single target nucleobase is a cytosine (C) and wherein the modification comprises conversion of the C to a thymine (T) or wherein the single target nucleobase is an adenosine (A) and wherein the modification comprises conversion of the A to a guanine (G).
38 - 40 . (canceled)
41 . The method of claim 1 , wherein the at least one amino acid substitution in CD117 is selected from the group consisting of: T13A, I39V, H40R, D45G, D52G, E53G, I54V, R55G, T59A, K65E, K65R, T67A, E76G, N77G, N77S, N77Y, K78E, Q79R, N80G, E81G, E81D, N99G, K100G, H101R, L124P, Y125H, D129E, D129G, N130D, N130G, D131G, D131N, T132A, T144A, N145D, N145G, N145Y, N145S, Y146C, F162P, F162L, I163T, I163V, M171T, I172T, V195A, L196P, K199G, I201V, S220G, Y221C, Q256R, E257D, E257G, K258E, Y259C, T303A, T304A, M318V, T322A, V323A, F324L, K342G, K342R, Y350H, M351T, R353G, T354A, T354I, R381G, K383G, T385A, Y418C, D419G, R420G, I438M, D439G, Q460R, T461A, K484G, N486G, and T488A.
42 - 44 . (canceled)
45 . The method of claim 1 , wherein the cell is from a subject having hemoglobinopathy, hematologic cancer, or a myeloproliferative disease.
46 . The method of claim 45 , wherein the cell is from a subject having sickle cell disease (SCD).
47 . The method of claim 45 , wherein the cell is from a subject having hereditary persistence of fetal hemoglobin (HPFH).
48 - 66 . (canceled)
67 . The method of claim 1 , wherein the one or more guide polynucleotides comprises a nucleic acid sequence selected from Table 23.
68 . The method of claim 1 , wherein the one or more guide polynucleotides comprise a nucleic acid sequence that hybridizes to the complement of a CD117 target sequence selected from the group consisting of:
CAAGCTATCTTCTTAGGGA;
GCAAGCTATCTTCTTAGGGAA;
ACTTACGACAGGCTCGTGAA;
TGACCAATTATTCCCTCAAG;
AGTGACCAATTATTCCCTCA;
ACTACAGTATTTGTAAACGA;
AAGACAACGACACGCTGGTC;
and
GGCTGTTATGCACTGATCCG.
69 - 75 . (canceled)
76 . A base editor system comprising a fusion protein or a polynucleotide encoding the fusion protein, wherein the fusion protein comprises a nucleic acid programmable DNA binding protein (napDNAbp) and a deaminase domain, and a guide polynucleotide comprising a nucleic acid sequence selected from Table 23.
77 - 100 . (canceled)
101 . A polynucleotide encoding the base editor system of claim 76 .
102 . A cell produced by the method of claim 1 .
103 - 109 . (canceled)
110 . A pharmaceutical composition comprising an effective amount of the cell of claim 102 .
111 . A method of treating a subject with a hemoglobinopathy, hematologic cancer, or myeloproliferative disease, the method comprising administering to the subject the pharmaceutical composition of claim 109 .
112 . A method of treating a subject with a hemoglobinopathy, hematologic cancer, or myeloproliferative disease, the method comprising administering to the subject a conditioning regimen comprising an antibody, antibody drug conjugate or chimeric antigen receptor expressing T-cell that selectively binds a cell surface protein and the cell of claim 102 , thereby treating the hemoglobinopathy, hematologic cancer, or myeloproliferative disease.
113 - 121 . (canceled)
122 . A kit comprising the cell of claim 102 .
123 . (canceled)