Granted Patent B2

US 12,486,502 · App. 17/715,444 · Granted Dec 2, 2025

Inventors: Anthony Nicholas (Oregon, WI); Erik W. Bush (Verona, WI); David Itiro Kasahara (Madison, WI); Casi M. Schienebeck (Deerfield, WI)

Assignee: Arrowhead Pharmaceuticals, Inc.

C12N15/113A61K9/0073A61P11/00C12N2310/11C12N2310/14

Abstract

Claims (33)

1 . An RNAi agent for inhibiting expression of a Receptor for Advanced Glycation End-products gene, comprising:

an antisense strand wherein nucleotides 1 through 21 (5′→3′) of the antisense strand comprise the nucleotide sequence UGAUGUUUUGAGCACCUACUC (SEQ ID NO:9) (5′ →3′); and

a sense strand comprising the modified nucleotide sequence:

gsaguagGfuGfcUfcaaaacauca (SEQ ID NO:14) (5′→3′);

wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage;

wherein at least one nucleotide of the antisense strand is a modified nucleotide or includes a modified internucleoside linkage.

2 . The RNAi agent of claim 1 , wherein the modified nucleotide is selected from the group consisting of: 2′-O-methyl nucleotide, 2′-fluoro nucleotide, 2′-deoxy nucleotide, 2′,3′-seco nucleotide mimic, locked nucleotide, 2′-F-arabino nucleotide, 2′-methoxyethyl nucleotide, abasic nucleotide, ribitol, inverted nucleotide, inverted 2′-O-methyl nucleotide, inverted 2′-deoxy nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, vinyl phosphonate-containing nucleotide, cyclopropyl phosphonate-containing nucleotide, and 3′-O-methyl nucleotide.

3 . The RNAi agent of claim 1 , wherein the sense strand comprises one or two inverted abasic residues.

4 . The RNAi agent of claim 1 , wherein the RNAi agent is comprised of a sense strand and an antisense strand that form a duplex having the nucleotide sequence pair selected from the group consisting of: SEQ ID NO: 609/14; SEQ ID NO: 5/14; SEQ ID NO: 6/14; SEQ ID NO: 616/14; SEQ ID NO: 617/14; SEQ ID NO: 618/14; SEQ ID NO: 5/11; SEQ ID NO: 6/11; and SEQ ID NO: 5/797.

5 . The RNAi agent of claim 1 , comprising an antisense strand that comprises, consists of, or consists essentially of the modified nucleotide sequence (5′→3′):

cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO:6);

wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, cPrpu represents 5′-cyclopropyl phosphonate-2′-O-methyl uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.

6 . The RNAi agent of claim 1 , wherein the sense strand comprises the nucleotide sequence (5′→3′):

Tri-SM6.1-αvβ6-(TA14)gsaguagGfuGfcUfcaaaacaucas(invAb) (SEQ ID NO:11); wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; invAb represents inverted abasic deoxyribonucleotide; and wherein Tri-SM6.1-αvβ6-(TA14) is of the formula:

wherein indicates the point of attachment to the RNAi agent.

7 . The RNAi agent of claim 1 , wherein the RNAi agent is linked to a targeting ligand.

8 . The RNAi agent of claim 7 , wherein the targeting ligand comprises the structure:

or a pharmaceutically acceptable salt thereof, or

or a pharmaceutically acceptable salt thereof,

wherein indicates the point of connection to the RNAi agent.

9 . The RNAi agent of claim 7 , wherein the targeting ligand has a structure selected from the group consisting of:

wherein indicates the point of connection to the RNAi agent.

10 . The RNAi agent of claim 9 , wherein the targeting ligand is of the formula:

wherein indicates the point of connection to the RNAi agent.

11 . A method for inhibiting expression of a Receptor for Advanced Glycation End-products gene in a cell, the method comprising introducing into a cell an effective amount of an RNAi agent of claim 1 .

12 . The method of claim 11 , wherein the cell is within a subject.

13 . An RNAi agent for inhibiting expression of a Receptor for Advanced Glycation End-products gene, comprising:

an antisense strand that comprises, consists of, or consists essentially of the modified nucleotide sequence (5′→3′):

cPrpusGfsasuguuuugaGfcAfcCfuacusc (SEQ ID NO:6); and

a sense strand that comprises, consists of, or consists essentially of the modified nucleotide sequence (5′→3′):

Tri-SM6.1-αvβ6-(TA14)gsaguagGfuGfcUfcaaaacaucas(invAb) (SEQ ID NO:11);

wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, Uf represents 2′-fluoro uridine; cPrpu represents 5′-cyclopropyl phosphonate-2′-O-methyl uridine; s represents a phosphorothioate linkage; invAb represents inverted abasic deoxyribonucleotide; wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides; and wherein Tri-SM6.1-αvβ6-(TA14) is of the formula:

wherein indicates the point of attachment to the RNAi agent.

Assignments (2)

Continuity (3)

References Cited (119)