OLIGONUCLEOTIDE COMPOUNDS FOR TREATMENT OF PREECLAMPSIA AND OTHER ANGIOGENIC DISORDERS
This disclosure relates to novel targets for angiogenic disorders. Novel oligonucleotides are also provided. Methods of using the novel oligonucleotides for the treatment of angiogenic disorders (e.g., preeclampsia) are also provided.
1 . A compound that binds to an intronic region of an mRNA encoding an sFLT1 protein, wherein the compound selectively inhibits expression of the sFLT1 protein in a cell or organism.
2 . The compound of claim 1 , comprising a single stranded (ss) RNA molecule or a double stranded (ds) RNA molecule that is between 15 and 35 bases in length.
3 . The compound of claim 2 , wherein the dsRNA molecule mediates degradation of the mRNA.
4 . The compound of claim 2 , comprising a dsRNA having a sense strand and an antisense strand, wherein the antisense strand comprises a region of complementarity which is substantially complementary to
(SEQ ID NO: 1)
5′ CTCTCGGATCTCCAAATTTA 3′,
(SEQ ID NO: 2)
5′ CATCATAGCTACCATTTATT 3′,
(SEQ ID NO: 3)
5′ ATTGTACCACACAAAGTAAT 3′
or
(SEQ ID NO: 4)
5′ GAGCCAAGACAATCATAACA 3′.
5 . The dsRNA of claim 4 , wherein said region of complementarity is complementary to at least 15, 16, 17 or 18 contiguous nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
6 . The dsRNA of claim 4 , wherein said region of complementarity contains no more than 3 mismatches with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4; or wherein said region of complementarity is fully complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.
7 - 10 . (canceled)
11 . The dsRNA of claim 4 , wherein said dsRNA comprises at least one modified nucleotide.
12 . The dsRNA of claim 11 , wherein said modified nucleotide is chosen from the group consisting of:
a 2′-O-methyl modified nucleotide, a 2′-fluoro modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative; or
a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.
13 . (canceled)
14 . The dsRNA of claim 12 , wherein said dsRNA comprises at least one 2′-O-methyl modified nucleotide, at least one 2′-fluoro modified nucleotide, at least one nucleotide comprising a 5′phosphorothioate group and a terminal nucleotide linked to a cholesteryl derivative.
15 . The dsRNA of claim 2 , said dsRNA having a 5′ end, a 3′ end and complementarity to a target, and comprising a first oligonucleotide and a second oligonucleotide, wherein:
(1) the first oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4;
(2) a portion of the first oligonucleotide is complementary to a portion of the second oligonucleotide;
(3) the second oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;
(4) the nucleotides at positions 2 and 14 from the 3′ end of the second oligonucleotide are 2′-methoxy-ribonucleotides; and
(5) the nucleotides of the second oligonucleotide are connected via phosphodiester or phosphorothioate linkages.
16 - 19 . (canceled)
20 . The dsRNA of claim 4 , wherein expression of the sFLT1 protein in the cell or organism is reduced from about 30% to about 50% or from about 30% to about 40%.
21 . (canceled)
22 . A therapeutic compound that binds to an intronic region of an mRNA encoding an sFLT1 protein, wherein the therapeutic compound selectively reduces expression of the sFLT1 protein, and wherein the therapeutic compound reduces one or more symptoms of preeclampsia (PE), postpartum PE, eclampsia or Hemolysis/Elevated Liver enzymes/Low Platelet count (HELLP) syndrome when administered to a subject in need thereof.
23 . The therapeutic compound of claim 22 , wherein the sFLT1 protein is selected from the group consisting of one or any combination of sFLT1-i13 short, sFLT1-i13 long and sFlt1-i15a.
24 . The therapeutic compound of claim 22 , comprising a first oligonucleotide and a second oligonucleotide, wherein the first oligonucleotide binds an intronic region of one or both of sFLT1-i13 short and sFLT1-i13 long, and the second oligonucleotide binds an intronic region of sFlt1-i15a.
25 . (canceled)
26 . The therapeutic compound of claim 22 , comprising a first dsRNA comprising a first sense strand and a first antisense strand and a second dsRNA comprising a second sense strand and a second antisense strand, wherein the first antisense strand comprises a first region of complementarity which is substantially complementary to SEQ ID NO:1 and the second antisense strand comprises a second region of complementarity which is substantially complementary to SEQ ID NO:2.
27 - 35 . (canceled)
36 . The first and second dsRNAs of claim 26 , wherein each dsRNA comprises a 5′ end, a 3′ end and complementarity to a target, wherein:
(1) the oligonucleotide comprises alternating 2′-methoxy-ribonucleotides and 2′-fluoro-ribonucleotides;
(2) the nucleotides at positions 2 and 14 from the 5′ end are not 2′-methoxy-ribonucleotides;
(3) the nucleotides are connected via phosphodiester or phosphorothioate linkages; and
(4) the nucleotides at positions 1-6 from the 3′ end, or positions 1-7 from the 3′ end, are connected to adjacent nucleotides via phosphorothioate linkages.
37 . A pharmaceutical composition comprising:
a first dsRNA comprising a first sense strand and a first antisense strand, wherein the first antisense strand comprises a region of complementarity which is substantially complementary to SEQ ID NO:1, and wherein the first antisense strand selectively targets one or both of an intronic region of sFLT-i13 short and an intronic region of sFLT-i13 long;
a second dsRNA comprising a second sense strand and a second antisense strand, wherein the second antisense strand comprises a region of complementarity which is substantially complementary to SEQ ID NO:2, and wherein the second antisense strand selectively targets an intronic region of sFLT-i15a; and
a pharmaceutically acceptable carrier.
38 . A method of treating or managing PE, postpartum PE, eclampsia or HELLP syndrome comprising administering to a subject in need of such treatment or management a therapeutically effective amount of the pharmaceutical composition of claim 37 .
39 - 41 . (canceled)
42 . A method of treating one or more symptoms of PE, postpartum PE, eclampsia or HELLP syndrome in a subject in need thereof, comprising administering to the subject the therapeutic compound of claim 26 .
43 . A method of treating one or more symptoms of an angiogenic disorder in a subject in need thereof, comprising administering to the subject the compound of claim 4 .
44 - 47 . (canceled)