TRANSTHYRETIN (TTR) iRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING TTR-ASSOCIATED OCULAR DISEASES

1 . A double stranded RNAi agent comprising a sense strand complementary to an antisense strand, wherein said antisense strand comprises a region complementary to part of an mRNA encoding transthyretin (TTR), wherein each strand independently has 14 to 30 nucleotides; wherein said double stranded RNAi agent comprises one or more lipophilic monomer, and wherein the lipophilic monomer is selected from the group consisting of:

.

2 . The double stranded RNAi agent of claim 1 , wherein said antisense strand comprises a sequence that is complementary to the nucleotide sequence 5′-TGGGATTTCATGTAACCAAGA – 3′ (SEQ ID NO: 11).

3 . The double stranded RNAi agent of claim 1 , wherein the sense and the antisense strands comprise less than ten or less than five 2′-fluoro modified nucleotides.

4 . (canceled)

5 . The double stranded RNAi agent of claim 1 , wherein the sense and the antisense strands do not comprise 2′-fluoro modified nucleotides.

6 . The double stranded RNAi agent of claim 1 , wherein the antisense strand comprises at least two phosphorothioate internucleotide linkages between the first five nucleotides counting from the 5′ end.

7 . The double stranded RNAi agent of claim 1 , wherein the sense and antisense strands comprise at least 50%, at least 60% or least 70% of 2′-OMe modified nucleotides.

8 . The double stranded RNAi agent of claim 1 , wherein the sense and/or antisense strands comprise at least 3, at least 4 or at least 5 2′-deoxy modified nucleotides.

9 . A double stranded RNAi agent for inhibiting expression of transthyretin (TTR) in a cell, wherein said double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region; wherein the sense strand comprises the nucleotide sequence 5′ – UGGGAUUUCAUGUAACCAAGA – 3′ (SEQ ID NO: 12) and the antisense strand comprises the nucleotide sequence 5′-UCUUGGUUACAUGAAAUCCCAUC -3′ (SEQ ID NO: 13); wherein said double stranded RNAi agent comprises one or more lipophilic monomer, and wherein the lipophilic monomer selected from the group consisting of

.

10 . The double stranded RNAi agent of claim 1 , wherein the sense strand comprises at least one, or at least two phosphorothioate that the 3′ -end.

11 . (canceled)

12 . The double stranded RNAi agent of claim 1 , further comprising a phosphate or phosphate mimic at the 5′-end of the antisense strand.

13 . The double stranded RNAi agent of claim 12 , wherein the phosphatemimic is a 5′-vinyl phosphonate (VP).

14 . The double stranded RNAi agent of claim 1 , wherein the antisense comprises at least one GNA in the seed region.

15 . The double stranded RNAi agent of claim 14 , wherein the seed region is at position 5-7 from the 5′-end of the antisense strand.

16 . The double stranded RNAi agent of claim 1 , wherein the antisense comprises at a GNA at position 7 from the 5′ -end of the antisense strand.

17 . The double stranded RNAi agent of claim 1 , further comprising a targeting ligand that targets a receptor which mediates delivery to an ocular tissue.

18 . The double stranded RNAi agent of claim 17 , wherein the targeting ligand is selected from the group consisting of trans-retinol, RGD peptide, LDL receptor ligand, and carbohydrate based ligands.

19 . The double stranded RNAi agent of claim 18 , wherein the RGD peptide is H-Gly-Arg-Gly-Asp-Ser-Pro-Lys-Cys-OH (SEQ ID NO: 14) or Cyclo(-Arg-Gly-Asp-D-Phe-Cys).

20 . A method of reducing the expression of a transthyretin (TTR) gene in a cell, comprising contacting said cell with a double stranded RNAi agent comprising

an antisense strand which is complementary to a TTR gene;

a sense strand which is complementary to said antisense strand; and

one or more lipophilic monomer, and wherein the lipophilic monomer is selected from the group consisting of

.

21 . A method of reducing the expression of transthyretin (TTR) in a subject, comprising administering to the subject a double stranded RNAi agent comprising: an antisense strand which is complementary to a TTR gene; a sense strand which is complementary to said antisense strand; and one or more lipophilic monomer, and wherein the lipophilic monomer

.

22 . The method of claim 21 , wherein the double stranded RNAi agent is administered intravitreally.

23 . The method of claim 21 , wherein the method reduces the expression of the TTR gene in an ocular tissue.