IP Library Patent Application 18036176
Patent Application
App. No. 18/036,176

RNA-Editing Compositions and Methods of Use

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
18/036,176
Abstract

Provided herein are engineered latent guide RNAs that bind target RNAs to form a guide-target RNA scaffold and are substrates for RNA editing entities, which chemically modify the base of a nucleotide of the target RNA. Also provided herein are compositions, vectors, and cells comprising the engineered latent guide RNAs disclosed herein and methods of use thereof.

Claims (149)

1 . An engineered guide RNA that, upon hybridization to a target RNA implicated in a disease or condition, forms a guide-target RNA scaffold comprising a structural feature selected from the group consisting of a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature substantially forms upon hybridization to the target RNA.

2 . The engineered guide RNA of claim 1 , wherein the guide-target RNA scaffold further comprises a mismatch.

3 . The engineered guide RNA of claim 2 , wherein the mismatch is an adenosine/cytosine (A/C) mismatch, wherein the adenosine (A) is present in the target RNA and the cytosine (C) is present in the engineered guide RNA.

4 . The engineered guide RNA of any one of claims 1 - 3 , wherein the guide-target RNA scaffold comprises a wobble base pair.

5 . The engineered guide RNA of any one of claims 1 - 3 , wherein the guide-target RNA scaffold is a substrate for an RNA editing entity that chemically modifies a base of a nucleotide in the target RNA.

6 . The engineered guide RNA of any one of claims 3 - 5 , wherein the RNA editing entity chemically modifies the adenosine in the target RNA to an inosine.

7 . The engineered guide RNA of any one of claims 1 - 6 , wherein the guide-target RNA scaffold comprises a structured motif comprising two or more structural features selected from the group consisting of a bulge, an internal loop, a hairpin, and any combination thereof.

8 . The engineered guide RNA of any one of claims 1 - 6 , wherein the guide-target RNA scaffold comprises at least two, three, four, five, six, seven, eight, nine, or 10 structural features selected from the group consisting of a bulge, an internal loop, a hairpin, and any combination thereof.

9 . The engineered guide RNA of any one of claims 1 - 8 , wherein the structural feature is a bulge.

10 . The engineered guide RNA of claim 9 , wherein the bulge is an asymmetric bulge.

11 . The engineered guide RNA of claim 9 , wherein the bulge is a symmetric bulge.

12 . The engineered guide RNA of any one of claims 9 - 11 , wherein the bulge comprises from 1 to 4 nucleotides of the engineered guide RNA and from 0 to 4 nucleotides of the target RNA.

13 . The engineered guide RNA of any one of claims 9 - 11 , wherein the bulge comprises from 0 to 4 nucleotides of the engineered guide RNA and from 1 to 4 nucleotides of the target RNA.

14 . The engineered guide RNA of claim 10 , wherein the asymmetric bulge is an X 1 /X 2 asymmetric bulge, wherein X 1 is the number of nucleotides of the target RNA in the asymmetric bulge and X 2 is the number of nucleotides of the engineered guide RNA in the asymmetric bulge, wherein the X 1 /X 2 asymmetric bulge is a 0/1 asymmetric bulge, a 1/0 asymmetric bulge, a 0/2 asymmetric bulge, a 2/0 asymmetric bulge, a 0/3 asymmetric bulge, a 3/0 asymmetric bulge, a 0/4 asymmetric bulge, a 4/0 asymmetric bulge, a 1/2 asymmetric bulge, a 2/1 asymmetric bulge, a 1/3 asymmetric bulge, a 3/1 asymmetric bulge, a 1/4 asymmetric bulge, a 4/1 asymmetric bulge, a 2/3 asymmetric bulge, a 3/2 asymmetric bulge, a 2/4 asymmetric bulge, a 4/2 asymmetric bulge, a 3/4 asymmetric bulge, or a 4/3 asymmetric bulge.

15 . The engineered guide RNA of claim 11 , wherein the symmetric bulge is an X 1 /X 2 symmetric bulge, wherein X 1 is the number of nucleotides of the target RNA in the symmetric bulge and X 2 is the number of nucleotides of the engineered guide RNA in the symmetric bulge, and wherein the X 1 /X 2 symmetric bulge a 2/2 symmetric bulge, a 3/3 symmetric bulge, or a 4/4 symmetric bulge.

16 . The engineered guide RNA of any one of claims 1 - 8 , wherein the structural feature comprises an internal loop.

17 . The engineered guide RNA of claim 16 , wherein the internal loop comprises an asymmetric internal loop.

18 . The engineered guide RNA of claim 16 , wherein the internal loop comprises a symmetric internal loop.

19 . The engineered guide RNA of claim 17 , wherein the asymmetric internal loop is an X 1 /X 2 asymmetric internal loop, wherein X 1 is the number of nucleotides of the target RNA in the asymmetric internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the asymmetric internal loop, and wherein the X 1 /X 2 asymmetric internal loop is a 5/6 asymmetric internal loop, a 6/5 asymmetric internal loop, a 5/7 asymmetric internal loop, a 7/5 asymmetric internal loop, a 5/8 asymmetric internal loop, a 8/5 asymmetric internal loop, a 5/9 asymmetric internal loop, a 9/5 asymmetric internal loop, a 5/10 asymmetric internal loop, a 10/5 asymmetric internal loop, a 6/7 asymmetric internal loop, a 7/6 asymmetric internal loop, a 6/8 asymmetric internal loop, a 8/6 asymmetric internal loop, a 6/9 asymmetric internal loop, a 9/6 asymmetric internal loop, a 6/10 asymmetric internal loop, a 10/6 asymmetric internal loop, a 7/8 asymmetric internal loop, a 8/7 asymmetric internal loop, a 7/9 asymmetric internal loop, a 9/7 asymmetric internal loop, a 7/10 asymmetric internal loop, a 10/7 asymmetric internal loop, a 8/9 asymmetric internal loop, a 9/8 asymmetric internal loop, a 8/10 asymmetric internal loop, a 10/8 asymmetric internal loop, or a 9/10 asymmetric internal loop, or a 10/9 asymmetric internal loop.

20 . The engineered guide RNA of claim 18 , wherein the symmetric internal loop is an X 1 /X 2 symmetric internal loop, wherein X 1 is the number of nucleotides of the target RNA in the symmetric internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the symmetric internal loop, and wherein the X 1 /X 2 symmetric internal loop is a 5/5 symmetric internal loop, a 6/6 symmetric internal loop, a 7/7 symmetric internal loop, a 8/8 symmetric internal loop, a 9/9 symmetric internal loop, a 10/10 symmetric internal loop, a 12/12 symmetric internal loop, a 15/15 symmetric internal loop, or a 20/20 symmetric internal loop.

21 . The engineered guide RNA of any one of claims 16 - 20 , wherein the internal loop is formed by at least 5 nucleotides on either the engineered guide RNA or the target RNA.

22 . The engineered guide RNA of any one of claims 16 - 21 , wherein the internal loop is formed by from 5 to 1000 nucleotides of either the engineered guide RNA or the target RNA.

23 . The engineered guide RNA of any one of claims 16 - 22 , wherein the internal loop is formed by from 5 to 50 nucleotides of either the engineered guide RNA or the target RNA.

24 . The engineered guide RNA of any one of claims 16 - 23 , wherein the internal loop is formed by from 5 to 20 nucleotides of either the engineered guide RNA or the target RNA.

25 . The engineered guide RNA of any one of claims 1 - 8 , wherein the structural feature comprises a hairpin.

26 . The engineered guide RNA of claim 25 , wherein the hairpin comprises a non-recruitment hairpin.

27 . The engineered guide RNA of claim 25 or 26 , wherein a loop portion of the hairpin comprises from about 3 to about 15 nucleotides in length.

28 . The engineered guide RNA of any one of claims 1 - 27 , wherein the engineered guide RNA further comprises at least two additional structural features that comprise at least two mismatches.

29 . The engineered guide RNA of claim 28 , wherein at least one of the at least two mismatches is a G/G mismatch.

30 . The engineered guide RNA of any one of claims 1 - 29 , wherein the engineered guide RNA further comprises an additional structural feature that comprises a wobble base pair.

31 . The engineered guide RNA of claim 30 , wherein the wobble base pair comprises a guanine paired with a uracil.

32 . The engineered guide RNA of claim 6 - 31 , wherein the target RNA comprises a 5′ guanosine adjacent to the adenosine in the target RNA that is chemically modified to an inosine by the RNA editing entity.

33 . The engineered guide RNA of claim 32 , wherein the engineered guide RNA comprises a 5′ guanosine adjacent to the cytosine of the A/C mismatch.

34 . The engineered guide RNA of any one of claims 5 - 33 , wherein the RNA editing entity is:

(a) an adenosine deaminase acting on RNA (ADAR);

(b) a catalytically active fragment of (a);

(c) a fusion polypeptide comprising (a) or (b); or

(d) any combination of these.

35 . The engineered guide RNA of any one of claims 5 - 34 , wherein the RNA editing entity is endogenous to a cell.

36 . The engineered guide RNA of any one of claims 5 - 35 , wherein the RNA editing entity comprises an ADAR.

37 . The engineered guide RNA of claim 36 , wherein the ADAR comprises human ADAR (hADAR).

38 . The engineered guide RNA of claim 36 , wherein the ADAR comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

39 . The engineered guide RNA of claim 36 , wherein the ADAR1 comprises ADAR1p110, ADAR1p150, or a combination thereof.

40 . The engineered guide RNA of any one of claims 1 - 39 , wherein the engineered guide RNA comprises a modified RNA base, an unmodified RNA base, or a combination thereof.

41 . The engineered guide RNA of any one of claims 1 - 40 , wherein the target RNA is an mRNA molecule.

42 . The engineered guide RNA of any one of claims 1 - 40 , wherein the target RNA is a pre-mRNA molecule.

43 . The engineered guide RNA of any one of claims 1 - 42 , wherein the target RNA is APP, ABCA4, SERPINA1, HEXA, LRRK2, CFTR, SNCA, MAPT, or LIPA, a fragment any of these, or any combination thereof.

44 . The engineered guide RNA of any one of claims 1 - 42 , wherein the target RNA encodes amyloid precursor polypeptide, ATP-binding cassette, sub-family A, member 4 (ABCA4) polypeptide, alpha-1 antitrypsin (AAT) polypeptide, hexosaminidase A enzyme, leucine-rich repeat kinase 2 (LRRK2) polypeptide, CFTR polypeptide, alpha synuclein polypeptide, Tau polypeptide, or lysosomal acid lipase polypeptide.

45 . The engineered guide RNA of claim 43 or 44 , wherein the target RNA encodes ABCA4 polypeptide.

46 . The engineered guide RNA of claim 45 , wherein the target RNA comprises a G to A substitution at position 5882, 6320, or 5714, relative to a wildtype ABCA4 gene sequence of accession number NC_000001.11:c94121149-93992837.

47 . The engineered guide RNA of claim 45 or 46 , wherein the guide-target RNA scaffold comprises one or more structural features selected from TABLE 7, TABLE, 9, TABLE 10, TABLE 11, TABLE 18, or TABLE 19.

48 . The engineered guide RNA of any one of claims 45 - 47 , wherein the guide-target RNA scaffold comprises a structural features selected from the group consisting of: (i) one or more X 1 /X 2 bulges, wherein X 1 is the number of nucleotides of the target RNA in the bulge and X 2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the one or more bulges is a 2/1 asymmetric bulge, a 1/0 asymmetric bulge, a 2/2 symmetric bulge, a 3/3 symmetric bulge, or a 4/4 symmetric bulge; (ii) an X 1 /X 2 internal loop, wherein X 1 is the number of nucleotides of the target RNA in the internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the internal loop is a 5/5 symmetric loop (iii) one or more mismatches, wherein the one or more mismatches is a G/G mismatch, an A/C mismatch, or a G/A mismatch, (iv) a G/U wobble base pair or a U/G wobble base pair, and (v) any combination thereof.

49 . The engineered guide RNA of claim 48 , wherein the guide-target RNA scaffold comprises a 2/1 asymmetric bulge, a 1/0 asymmetric bulge, a G/G mismatch, an A/C mismatch, and a 3/3 symmetric bulge.

50 . The engineered guide RNA of any one of claims 45 - 49 , wherein the engineered guide RNA has a length of from 80 to 175 nucleotides.

51 . The engineered guide RNA of any one of claims 45 - 50 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 21, SEQ ID NO: 29, SEQ ID NO: 11, SEQ ID NO: 22, SEQ ID NO: 30, SEQ ID NO: 12, SEQ ID NO: 339-SEQ ID NO: 341, or SEQ ID NO: 292-SEQ ID NO: 296.

52 . The engineered guide RNA of claim 45 - 50 , wherein the engineered guide RNA comprises a polynucleotide at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 11-34, 58, 218-289, 291-296, or 328-343.

53 . The engineered guide RNA of claim 43 or 44 , wherein the target RNA encodes LRRK2 polypeptide.

54 . The engineered guide RNA of claim 53 , wherein the LRRK2 polypeptide comprises a mutation selected from the group consisting of: E10L, A30P, S52F, E46K, A53T, L119P, A211V, C228S, E334K, N363S, V366M, A419V, R506Q, N544E, N551K, A716V, M712V, 1723V, P755L, R793M, 1810V, K871E, Q923H, Q930R, R1067Q, S1096C, Q1111H, I1122V, A1151T, L1165P, I1192V, H1216R, 51228T, P1262A, R1325Q, I1371V, R1398H, T1410M, D1420N, R1441G, R1441H, A1442P, P1446L, V1450I, K1468E, R1483Q, R1514Q, P1542S, V1613A, R1628P, M1646T, 51647T, Y1699C, R1728H, R1728L, L1795F, M1869V, M1869T, L1870F, E1874X, R1941H, Y2006H, 12012T, G2019S, I2020T, T2031S, N2081D, T2141M, R2143H, Y2189C, T2356I, G2385R, V2390M, E2395K, M2397T, L2466H, or Q2490NfsX3.

55 . The engineered guide RNA of claim 53 or 54 , wherein the guide-target RNA scaffold comprises one or more structural features selected from TABLE 12, TABLE 15, TABLE 25, TABLE 26, TABLE 27, TABLE 17, or TABLE 20.

56 . The engineered guide RNA of any one of claims 53 - 55 , wherein the guide-target RNA scaffold comprises one or more structural features selected from the group consisting of: (i) one or more X 1 /X 2 bulges, wherein X 1 is the number of nucleotides of the target RNA in the bulge and X 2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the one or more bulges is a 0/1 asymmetric bulge, a 2/2 symmetric bulge, a 3/3 symmetric bulge, or a 4/4 symmetric bulge; (ii) one or more X 1 /X 2 internal loops, wherein X 1 is the number of nucleotides of the target RNA in the internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the one or more internal loops is a 5/0 asymmetric internal loop, a 5/4 asymmetric internal loop, a 5/5 symmetric internal loop, a 6/6 symmetric internal loop, a 7/7 symmetric internal loop, or a 10/10 symmetric internal loop; (iii) one or more mismatches, wherein the one or more mismatches is an A/C mismatch, an A/G mismatch, a C/U mismatch, a G/A mismatch, or a C/C mismatch, (iv) a G/U wobble base pair or a U/G wobble base pair, and (v) any combination thereof.

57 . The engineered guide RNA of claim 56 , wherein the guide-target RNA scaffold comprises a 6/6 symmetrical internal loop, an A/C mismatch, an A/G mismatch, and a C/U mismatch.

58 . The engineered guide RNA of any one of claims 53 - 57 , wherein the engineered guide RNA has a length of from 80 to 175 nucleotides.

59 . The engineered guide RNA of any one of claims 53 - 58 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to SEQ ID NO: 30, SEQ ID NO: 344, or SEQ ID NO: 345.

60 . The engineered guide RNA of claims 53 - 58 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 35-42, 46-52, 111-207, or 344-345.

61 . The engineered guide RNA of claim 43 or 44 , wherein the target RNA encodes SNCA polypeptide.

62 . The engineered guide RNA of claim 61 , wherein the engineered guide RNA hybridizes to a sequence of the target RNA selected from the group consisting of: a 5′ untranslated region (UTR), a 3′ UTR, and a translation initiation site of an SNCA gene.

63 . The engineered guide RNA of claim 61 or 62 , wherein the guide-target RNA scaffold comprises one or more structural features selected from TABLE 21, TABLE 23, or TABLE 28.

64 . The engineered guide RNA of any one of claims 61 - 63 , wherein the guide-target RNA scaffold comprises one or more structural features selected from the group consisting of: (i) an X 1 /X 2 bulge, wherein X 1 is the number of nucleotides of the target RNA in the bulge and X 2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the bulge is a 4/4 symmetric bulge; (ii) one or more X 1 /X 2 internal loops, wherein X 1 is the number of nucleotides of the target RNA in the internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the one or more internal loop is a 5/5 symmetric loop, an 8/8 symmetric loop, or a 49/4 asymmetric loop; (iii) one or more mismatches, wherein the one or more mismatches is an A/C mismatch, a G/G mismatch, a G/A mismatch, a U/C mismatch, or an A/A mismatch, (iv) any combination thereof.

65 . The engineered guide RNA of claim 64 , wherein the engineered guide RNA has a length of from 80 to 175 nucleotides.

66 . The engineered guide RNA of any one of claims 61 - 64 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 59-101, 104-108, and 208-217.

67 . The engineered guide RNA of claim 43 or 44 , wherein the target RNA encodes SERPINA1.

68 . The engineered guide RNA of claim 67 , wherein the target RNA comprises a G to A substitution at position 9989, relative to a wildtype SERPINA1 gene sequence of accession number NC_000014.9:c94390654-94376747.

69 . The engineered guide RNA of claim 67 or 68 , wherein the guide-target RNA scaffold comprises one or more structural features selected from TABLE 5, TABLE 29, TABLE 30, TABLE 31, TABLE 32, TABLE 33, TABLE 34, TABLE 35, or TABLE 36.

70 . The engineered guide RNA of any one of claims 67 - 69 , wherein the guide-target RNA scaffold comprises one or more structural features selected from the group consisting of: (i) one or more X 1 /X 2 bulges, wherein X 1 is the number of nucleotides of the target RNA in the bulge and X 2 is the number of nucleotides of the engineered guide RNA in the bulge, and wherein the bulge is a 0/2 asymmetric bulge, a 0/3 asymmetric bulge, a 1/0 asymmetric bulge, a 2/0 asymmetric bulge, a 2/2 symmetric bulge, a 3/0 asymmetric bulge, a 2/2 symmetric bulge, or a 3/3 symmetric bulge; (ii) an X 1 /X 2 internal loop, wherein X 1 is the number of nucleotides of the target RNA in the internal loop and X 2 is the number of nucleotides of the engineered guide RNA in the internal loop, and wherein the internal loop is a 5/5 symmetric internal loop; (iii) one or more mismatches, wherein the one or more mismatches is an A/C mismatch, an A/A mismatch, and a G/A mismatch, (iv) a G/U wobble base pair, or a U/G wobble base pair; and (v) any combination thereof.

71 . The engineered guide RNA of claim 70 , wherein the engineered guide RNA has a length of from 80 to 175 nucleotides.

72 . The engineered guide RNA of any one of claims 67 - 71 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 6-10, 102-103 or 297-327.

73 . The engineered guide RNA of claim 1 - 72 , wherein the base of the nucleotide of the target RNA that is modified by the RNA editing entity is comprised in a point mutation of the target RNA.

74 . The engineered guide RNA of claim 73 , wherein the point mutation comprises a missense mutation.

75 . The engineered guide RNA of claim 73 , wherein the point mutation is a nonsense mutation.

76 . The engineered guide RNA of claim 75 , wherein the nonsense mutation is a premature UAA stop codon.

77 . The engineered guide RNA of any one of claims 1 - 76 , wherein the structural feature increases selectivity of editing a target adenosine in the target RNA relative to an otherwise comparable guide RNA lacking the structural feature.

78 . The engineered guide RNA of any one of claims 1 - 77 , wherein the structural feature decreases an amount of RNA editing of local off-target adenosines within 200, within 100, within 50, within 25, within 10, within 5, within 2, or 1 within 1 nucleotide 5′ or 3′ of a target adenosine in the target RNA by the RNA editing entity, relative to an otherwise comparable guide RNA lacking the structural feature.

79 . An engineered RNA comprising:

(a) the engineered guide RNA of any one of claims 1 - 78 ,

(b) a U7 snRNA hairpin sequence, a SmOPT sequence, or a combination thereof.

80 . The engineered RNA of claim 79 , wherein the U7 hairpin has a sequence of

(SEQ ID NO: 389)

TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT

or

(SEQ ID NO: 394)

CAGGTTTTCTGACTTCGGTCGGAAAACCCCT.

81 . The engineered RNA of claim 79 , wherein the SmOPT sequence has a sequence of

(SEQ ID NO: 390)

AATTTTTGGAG.

82 . A polynucleotide encoding the engineered guide RNA of any one of claims 1 - 78 or the engineered RNA of any one of claims 79 - 81 .

83 . A delivery vector comprising the engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , or the polynucleotide of claim 82 .

84 . The delivery vector of claim 83 , wherein the delivery vector is a viral vector.

85 . The delivery vector of claim 84 , wherein the viral vector is an adeno-associated viral (AAV) vector or a derivative thereof.

86 . The delivery vector of claim 85 , wherein the AAV vector is from an adeno-associated virus having a serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV 11, AAV 12, AAV13, AAV 14, AAV 15, AAV 16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16 and AAVhu68.

87 . The delivery vector of claim 85 or 86 , wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV or any combination thereof.

88 . The delivery vector of any one of claims 85 - 87 , wherein the AAV vector comprises a genome comprising a replication gene and inverted terminal repeats from a first AAV serotype and a capsid protein from a second AAV serotype.

89 . The delivery vector of any one of claims 85 - 88 , wherein the AAV vector is an AAV 2/5 vector, an AAV 2/6 vector, an AAV 2/7 vector, an AAV2/8 vector, or an AAV 2/9 vector.

90 . The delivery vector of claim 88 , wherein the inverted terminal repeats comprise a 5′ inverted terminal repeat, a 3′ inverted terminal repeat, and a mutated inverted terminal repeat.

91 . The delivery vector of claim 90 , wherein the mutated inverted terminal repeat lacks a terminal resolution site.

92 . A pharmaceutical composition comprising:

(a) engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , or the delivery vector of any one of claims 83 - 91 , and

(b) a pharmaceutically acceptable: excipient, carrier, or diluent.

93 . The pharmaceutical composition of claim 92 , in unit dose form.

94 . The pharmaceutical composition of claim 92 or 93 , further comprising an additional therapeutic agent.

95 . The pharmaceutical composition of claim 94 , wherein the additional therapeutic agent comprises an ammonia reducer, a beta blocker, a synthetic hormone, an antibiotic, or an antiviral drug, a vascular endothelial growth factor (VEGF) inhibitor, a stem cell treatment, a vitamin or modified form thereof, or any combination thereof.

96 . A method of editing a target RNA in a cell, the method comprising: administering to the cell an effective amount of the engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 .

97 . A method of treating a disease in a subject, the method comprising administering to the subject an effective amount of the engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 .

98 . The method of claim 96 , wherein the engineered guide RNA is administered as a unit dose.

99 . The method of claim 98 , wherein the unit dose is an amount sufficient to treat the subject.

100 . The method of any one of claims 96 - 99 , wherein the administering is intrathecal, intraocular, intravitreal, retinal, intravenous, intramuscular, intraventricular, intracerebral, intracerebellar, intracerebroventricular, intraperenchymal, subcutaneous, or a combination thereof.

101 . The method of any one of claims 96 - 100 , wherein the disease comprises a neurological disease.

102 . The method of claim 101 , wherein the neurological disease comprises Parkinson's disease, Alzheimer's disease, a Tauopathy, or dementia.

103 . The method of claim 101 or 102 , wherein the neurological disease is associated with elevated levels of SNCA polypeptide, relative to a healthy subject that does not have the neurological disease or condition.

104 . The method of claim 103 , wherein the engineered guide RNA hybridizes to a sequence of a target RNA encoding the SNCA polypeptide selected from the group consisting of: a 5′ untranslated region (UTR), a 3′ UTR, and a translation initiation site of SNCA; wherein hybridization produces a guide-target RNA scaffold that is a substrate for an RNA editing entity that chemically modifies a base of a nucleotide in the sequence of the target RNA, thereby reducing levels of the SNCA polypeptide.

105 . The method of claim 104 , wherein the engineered guide RNA hybridizes to a sequence of a target RNA encoding the translation initiation site of SNCA.

106 . The method of any one of claims 103 - 105 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 59-101, 104-108, and 208-217.

107 . The method of any one of claims 103 - 106 , wherein the engineered guide RNA comprises has a percent on-target editing for ADAR2 of at least about 90%.

108 . The method of claim 101 or 102 , wherein the neurological disease is associated with a mutation of an LRRK2 polypeptide encoded by the target RNA, wherein the mutation is selected from the group consisting of: E10L, A30P, S52F, E46K, A53T, L119P, A211V, C228S, E334K, N363S, V366M, A419V, R506Q, N544E, N551K, A716V, M712V, 1723V, P755L, R793M, 1810V, K871E, Q923H, Q930R, R1067Q, S1096C, Q1111H, I1122V, A1151T, L1165P, I1192V, H1216R, S1228T, P1262A, R1325Q, I1371V, R1398H, T1410M, D1420N, R1441G, R1441H, A1442P, P1446L, V1450I, K1468E, R1483Q, R1514Q, P1542S, V1613A, R1628P, M1646T, S1647T, Y1699C, R1728H, R1728L, L1795F, M1869V, M1869T, L1870F, E1874X, R1941H, Y2006H, 12012T, G2019S, I2020T, T2031S, N2081D, T2141M, R2143H, Y2189C, T2356I, G2385R, V2390M, E2395K, M2397T, L2466H, or Q2490NfsX3.

109 . The method of claim 101 or 102 , wherein the neurological disease is associated with a mutation of an LRRK2 polypeptide encoded by the target RNA, wherein the mutation is a G2019S mutation.

110 . The method of any one of claims 108 - 114 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 35-42, 46-52, 111-207, or 344-345.

111 . The method of any one of claims 108 - 110 , wherein the engineered guide RNA comprises has a percent on-target editing for ADAR1 of at least about 60% or a percent on-target editing for ADAR2 of at least about 90%.

112 . The method of any one of claims 96 - 100 , wherein the disease comprises a liver disease.

113 . The method of claim 112 , wherein the liver disease comprises liver cirrhosis.

114 . The method of claim 112 , wherein the liver disease is alpha-1 antitrypsin (AAT) deficiency.

115 . The method of claim 114 , wherein the AAT deficiency is associated with a G to A substitution at position 9989 of a wildtype SERPINA1 gene sequence of accession number NC_000014.9:c94390654-94376747.

116 . The method of claim 114 or 115 , wherein the engineered latent wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 6-10, 102-103 or 297-327.

117 . The method of any one of claims 114 - 116 , wherein the engineered guide RNA comprises has a percent on-target editing for ADAR1 of at least about 60% or a percent on-target editing for ADAR2 of at least about 90%.

118 . The method of any one of claims 96 - 100 , wherein the disease is a macular degeneration.

119 . The method of claim 118 , wherein the macular degeneration is Stargardt Disease.

120 . The method of claim 119 , wherein the Stargardt disease is associated with a G to A substitution at position 5882, 6320, or 5714 of a wildtype ABCA4 gene sequence of accession number NC_000001.11:c94121149-93992837.

121 . The method of claim 120 , wherein the Stargardt disease is associated with a G to A substitution at position 5882.

122 . The method of claim 119 or 120 , wherein the engineered guide RNA comprises a polynucleotide having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to any one of SEQ ID NO: 11-34, 58, 218-289, 291-296, or 328-343.

123 . The method of any one of claims 120 - 122 , wherein the engineered guide RNA comprises has a percent on-target editing for ADAR1 of at least about 70% or a percent on-target editing for ADAR2 of at least about 80%.

124 . The method of any one of claims 96 - 123 , wherein the subject is diagnosed with the disease or the condition.

125 . The engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for use as a medicament.

126 . The engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for use in treatment of a neurological disease.

127 . The engineered guide RNA, polynucleotide, delivery vector, or pharmaceutical composition for the use of claim 127 , wherein the neurological disease is Parkinson's disease, Alzheimer's disease, a Tauopathy, or dementia.

128 . The engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for use in treatment of a liver disease.

129 . The engineered guide RNA, polynucleotide, delivery vector, or pharmaceutical composition for the use of claim 128 , wherein the liver disease comprises liver cirrhosis.

130 . The engineered guide RNA, polynucleotide, delivery vector, or pharmaceutical composition for the use of claim 128 , wherein the liver disease is alpha-1 antitrypsin (AAT) deficiency.

131 . The engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for use in treatment of macular degeneration.

132 . The engineered guide RNA, polynucleotide, delivery vector, or pharmaceutical composition for the use of claim 131 , wherein the macular degeneration is Stargardt disease.

133 . Use of the engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for the manufacture of a medicament.

134 . Use of the engineered guide RNA of any one of claims 1 - 78 , the engineered RNA of any one of claims 79 - 81 , the polynucleotide of claim 82 , the delivery vector of any one of claims 83 - 91 , or the pharmaceutical composition of any one of claims 92 - 95 , for the manufacture of a medicament for the treatment of a neurological disease, a liver disease or macular degeneration.

Assignments (2)
CHANGE OF ADDRESS Recorded Jun 6, 2023
From: SHAPE THERAPEUTICS INC.
To: SHAPE THERAPEUTICS INC.
Reel/Frame 063873/0838 →
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded May 10, 2023
From: SAVVA, YIANNIS; SULLIVAN, RICHARD; BOOTH, BRIAN; BRIGGS, ADRIAN; BOSE, DEBOJIT; BYRNE, SUSAN; BURLEIGH, STEPHEN
To: SHAPE THERAPEUTICS INC.
Reel/Frame 063590/0351 →