Granted Patent B2

US 12,378,554 · App. 18/178,206 · Granted Aug 5, 2025

Inventors: Robert H. Brown, Jr. (Needham, MA); Jonathan K. Watts (Worcester, MA); Helene Tran (Shrewsbury, MA); Michael Moazami (Worcester, MA)

Assignee: UNIVERSITY OF MASSACHUSETTS

C12N15/113C12N2310/11C12N2310/315C12N2310/321C12N2310/3231C12N2310/3341

Abstract

Claims (40)

1. An antisense oligonucleotide comprising a region of complementarity that is at least about 80% complementary to a chromosome 9 open reading frame 72 (C9ORF72) antisense transcript sequence of 5′ GAAAGUAAAAAUGCGUCGAG 3′ (SEQ ID NO: 1), 5′ CUCCUUGUUUUCUUCUGGUU 3′ (SEQ ID NO: 2), 5′ CAGGUCUUUUCUUGUUCACC 3′ (SEQ ID NO: 3), or 5′ CCUCCUUGUUUUCUUCUGGU 3′ (SEQ ID NO: 4), wherein the antisense oligonucleotide comprises internucleotide linkages from 5′ to 3′ of sooosssssssssssooos, wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage.

2. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises 8 to 80 nucleotides in length.

3. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises the formula:

A-B-C

wherein:

A comprises from about 0 to about 8 modified nucleotides;

B comprises from about 4 to about 18 deoxyribonucleic acid (DNA) nucleotides and/or DNA-like nucleotides; and

C comprises from about 0 to about 8 modified nucleotides, and

wherein the overall length of the antisense oligonucleotide is about 10 to about 30 nucleotides.

4. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide is conjugated to a ligand.

5. An antisense oligonucleotide comprising the sequence CsToCoGoA sCsGsCsAsTsTsTsTsTsAs CoToToTsC (SEQ ID NO: 5), wherein:

s represents a phosphorothioate internucleotide linkage;

o represents a phosphodiester internucleotide linkage;

A is an adenosine comprising a 2′-O-(2-methoxyethyl) modification;

G is a guanosine comprising a 2′-O-(2-methoxyethyl) modification;

C is a cytidine comprising a 2′-O-(2-methoxyethyl) modification;

T is a thymine comprising a 2′-O-(2-methoxyethyl) modification; and

each cytidine is a 5-methylcytosine.

6. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises 10 to 30 nucleotides in length.

7. The antisense oligonucleotide of claim 1 , wherein the antisense oligonucleotide comprises one or more modified nucleotides.

8. The antisense oligonucleotide of claim 7 , wherein the one or more modified nucleotides each independently comprise a modification of a ribose group, a nucleobase group, or a combination thereof.

9. The antisense oligonucleotide of claim 8 , wherein each modification of the ribose group is a 2′-O-methyl, a 2′-fluoro, a 2′-H, a 2′-O-(2-methoxyethyl) (MOE), a 2′-O-alkyl, a 2′-O-alkoxy, a 2′-O-alkylamino, a 2′-NH 2 , or a constrained nucleotide.

10. The antisense oligonucleotide of claim 9 , wherein the constrained nucleotide is a locked nucleic acid (LNA), an ethyl-constrained nucleotide, a 2′-(S)-constrained ethyl (S-cEt) nucleotide, a constrained MOE, a 2′-0,4′-C-aminomethylene bridged nucleic acid (2′,4′-BNA NC ), an alpha-L-locked nucleic acid, a tricyclo-DNA, or any combination thereof.

11. The antisense oligonucleotide of claim 9 , wherein the modification of the ribose group comprises a 2′-O-(2-methoxyethyl) (MOE).

12. The antisense oligonucleotide of claim 8 , wherein each modification of the nucleobase group is a 2-thiouridine, a 4-thiouridine, an N 6 -methyladenosine, a pseudouridine, a 2,6-diaminopurine, an inosine, a thymidine, a 5-methylcytosine, a 5-substituted pyrimidine, an isoguanine, an isocytosine, or a halogenated aromatic groups.

13. The antisense oligonucleotide of claim 12 , wherein the modification of the nucleobase group comprises a 5-methylcytosine.

14. The antisense oligonucleotide of claim 3 , wherein A comprises from about 2 to about 6 modified nucleotides, B comprises from about 6 to about 12 DNA nucleotides and/or DNA-like nucleotides, and C comprises from about 2 to about 6 modified nucleotides.

15. The antisense oligonucleotide of claim 3 , wherein A comprises about 5 modified nucleotides, B comprises about 8 DNA nucleotides and/or DNA-like nucleotides, and C comprises about 5 modified nucleotides.

16. The antisense oligonucleotide of claim 3 , wherein A comprises about 5 modified nucleotides, B comprises about 10 DNA nucleotides and/or DNA-like nucleotides, and C comprises about 5 modified nucleotides.

17. The antisense oligonucleotide of claim 3 , wherein:

A comprises from about 2 to about 6 2′-O-(2-methoxyethyl) (MOE) modified nucleotides, B comprises from about 6 to about 12 DNA-like nucleotides, and C comprises from about 2 to about 6 locked 2′-O-(2-methoxyethyl) (MOE) modified nucleotides;

A comprises about 5 2′-O-(2-methoxyethyl) (MOE) modified nucleotides, B comprises about 8 DNA-like nucleotides, and C comprises about 5 locked 2′-O-(2-methoxyethyl) (MOE) modified nucleotides; or

A comprises about 5 2′-O-(2-methoxyethyl) (MOE) modified nucleotides, B comprises about 10 DNA-like nucleotides, and C comprises about 5 locked 2′-O-(2-methoxyethyl) (MOE) modified nucleotides.

18. The antisense oligonucleotide of claim 1 , comprising:

a nucleic acid sequence with at least 90% sequence identity to the nucleic acid sequence set forth in any one of SEQ ID NOs: 5-8 (SEQ ID NO: 5-CTCGACGCATTTTTACTTTC), (SEQ ID NO: 6-AACCAGAAGAAAACAAGGAG), (SEQ ID NO: 7-GGTGAACAAGAAAAGACCTG), (SEQ ID NO: 8-ACCAGAAGAAAACAAGGAGG); or

a sequence modification pattern of XsXoXoXoX sXsXsXsXsXsXsXsXsXsXs XoXoXoXsX , wherein:

s represents a phosphorothioate internucleotide linkage;

o represents a phosphodiester internucleotide linkage; and

X is an adenosine, a guanosine, a cytidine, or a thymine comprising a 2′-O-(2-methoxyethyl) modification,

optionally wherein each cytosine is a 5-methylcytosine.

Assignments (1)

Continuity (3)

References Cited (233)