IP Library Patent Application 18225919
Patent Application
App. No. 18/225,919

TRANSTHYRETIN (TTR) iRNA COMPOSITIONS AND METHODS OF USE THEREOF FOR TREATING OR PREVENTING TTR-ASSOCIATED OCULAR DISEASES

Loading inventors, assignments & file history…
Monitor This Case
Get email alerts when status or documents change.
Order Certified Copies
Most orders are placed with the USPTO same day — all within 24 business hours.
Order via The Patent Place →
Pre-filled with this patent's details
Quick Facts
Patent No.
US None
App. No.
18/225,919
Abstract

The present invention provides iRNA agents, e.g., double stranded iRNA agents, that target the transthyretin (TTR) gene and methods of using such iRNA agents for treating or preventing TTR-associated ocular diseases.

Claims (62)

1 - 3 . (canceled)

4 . A double stranded RNAi agent for inhibiting expression of TTR in a cell, wherein said double stranded RNAi agent comprises a sense strand and an antisense strand forming a double stranded region;

wherein the sense strand comprises the nucleotide sequence 5′-UGGGAUUUCAUGUAACCAAGA—3′ of (SEQ ID NO:12) and the antisense strand comprises the nucleotide sequence 5′—UCUUGGUUACAUGAAAUCCCAUC -3′ of(SEQ ID NO: 13);

wherein substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand comprise a modification; and

wherein one or more lipophilic moieties are conjugated to one or more internal positions on at least one strand, or one or more positions on at least one strand within the double stranded region.

5 . The double stranded RNAi agent of claim 4 , wherein the sense strand comprises a nucleotide sequence differing by no more than 4 modified nucleotides from the nucleotide sequence of 5′—usgsggauUfuCfAfUfguaaccaaga—3′ of SEQ ID NO: 10 and the antisense strand comprises a nucleotide sequence differing by no more than 4 modified nucleotides from the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc—3′ of SEQ ID NO: 7,

wherein a, c, g, and u are 2′-O-methyladenosine-3′-phosphate, 2′-O-methylcytidine-3′-phosphate, 2′-O-methylguanosine-3′-phosphate, and 2′-O-methyluridine-3′-phosphate, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine-3′-phosphate, 2′-fluorocytidine-3′-phosphate, 2′-fluoroguanosine-3′-phosphate, and 2′-fluorouridine-3′-phosphate, respectively; and s is a phosphorothioate linkage.

6 . (canceled)

7 . The double stranded RNAi agent of claim 4 , wherein the one or more lipophilic moieties are conjugated to the one or more internal positions on at least one strand, or the one or more positions on at least one strand within the double stranded region, via a linker or carrier.

8 - 14 . (canceled)

15 . The double stranded RNAi agent of claim 4 , wherein the one or more internal positions include all positions except the terminal two positions from each end of the at least one strand and positions 11-13 on the sense strand, counting from the 3′-end, and positions 12-14 on the antisense strand, counting from the 5′-end.

16 - 22 . (canceled)

23 . The double stranded RNAi agent of claim 4 , wherein the one or more lipophilic moieties are conjugated to the one or more of the internal positions selected from the group consisting of positions 4-8 and 13-18 on the sense strand, and positions 6-10 and 15-18 on the antisense strand, counting from the 5′ end of each strand.

24 . The double stranded RNAi agent of claim 23 , wherein the one or more lipophilic moieties are conjugated to the one or more of the internal positions selected from the group consisting of positions 5, 6, 7, 15, and 17 on the sense strand, and positions 15 and 17 on the antisense strand, counting from the 5′-end of each strand.

25 . (canceled)

26 . The double stranded RNAi agent of claim 4 ,

(a)wherein the lipophilic moiety is an aliphatic, alicyclic, or polyalicyclic compound;

(b)wherein the lipophilic moiety is selected from the group consisting of lipid, cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3—(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine;

(c) wherein the lipophilic moiety contains a saturated or unsaturated C4—C30 hydrocarbon chain, and an optional functional group selected from the group consisting of hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne;

(d) wherein the lipophilic moiety contains a saturated or unsaturated C6—C18 hydrocarbon chain; and/or

(e) wherein the lipophilic moiety contains a saturated or unsaturated C16 hydrocarbon chain.

27 - 34 . (canceled)

35 . The double-stranded iRNA agent of claim 4 , wherein the lipophilic moiety is conjugated to a nucleobase, sugar moiety, or internucleosidic linkage.

36 - 57 . (canceled)

58 . The double stranded RNAi agent of claim 4 , further comprising at least one phosphorothioate or methylphosphonate internucleotide linkage.

59 - 78 . (canceled)

79 . The double stranded RNAi agent of claim 4 , wherein the sense strand and the antisense strand comprise sense and antisense strand nucleotide sequences selected from the group consisting of

5'- usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5'- VPuCfuugGfuuAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 62;

5' - usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5' - VPusCfsuugGf(Tgn)uAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 102; and

5'- usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5'- usCfsuugGfuuAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 16,

wherein a, c, g, and u are 2′-O-methyladenosine-3′-phosphate, 2′-O-methylcytidine-3′-phosphate, 2′-O-methylguanosine-3′-phosphate, and 2′-O-methyluridine-3′-phosphate, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine-3′-phosphate, 2′-fluorocytidine-3′-phosphate, 2′-fluoroguanosine-3′-phosphate, and 2′-fluorouridine-3′-phosphate, respectively; (Uhd) is 2′-O-hexadecyl-uridine-3′-phosphate,; (Tgn) is thymidine-glycol nucleic acid (GNA)S-Isomer; s is a phosphorothioate linkage; and VP is a vinyl phosphonate.

80 . A double stranded ribonucleic acid (RNAi) agent that inhibits expression of transthyretin (TTR) in a cell, comprising a sense strand and an antisense strand forming a double stranded region,

wherein each of the sense strand and the antisense strand independently comprise nucleotide sequences differing by no more than 4 modified nucleotides from the sense and antisense strand nucleotide sequences of a duplex selected from the group consisting of

5'- usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5'- VPusCfsuugGfuuAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 17;

5'- usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5'- VPuCfuugGfuuAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 62;

5' - usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5' - VPusCfsuugGf(Tgn)uAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 102; and

5'- usgsgga(Uhd)UfuCfAfUfguaaccaasgsa - 3' of SEQ ID NO: 15 and

5'- usCfsuugGfuuAfcaugAfaAfucccasusc - 3' of SEQ ID NO: 16,

wherein a, c, g, and u are 2′-O-methyladenosine-3′-phosphate, 2′-O-methylcytidine-3′-phosphate, 2′-O-methylguanosine-3′-phosphate, and 2′-O-methyluridine-3′-phosphate, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine-3′-phosphate, 2′-fluorocytidine-3′-phosphate, 2′-fluoroguanosine-3′-phosphate, and 2′-fluorouridine-3′-phosphate, respectively; (Uhd) is 2′-O-hexadecyl-uridine-3′-phosphate; (Tgn) is thymidine-glycol nucleic acid (GNA)S-Isomer; s is a phosphorothioate linkage; and VP is a vinyl phosphonate.

81 - 83 . (canceled)

84 . The double stranded RNAi agent of claim 80 , wherein the sense strand comprises the nucleotide sequence 5′—usgsgga(Uhd)UfuCfAfUfguaaccaasgsa—3′ of SEQ ID NO: 15 and the antisense strand comprises the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc-3′ of(SEQ ID NO: 16).

85 . The double stranded RNAi agent of claim 80 , wherein the sense strand consists of the nucleotide sequence 5′—usgsgga(Uhd)UfuCfAfUfguaaccaasgsa—3′ of SEQ ID NO: 15 and the antisense strand comprises the nucleotide sequence 5′-usCfsuugGfuuAfcaugAfaAfucccasusc—3′ of SEQ ID NO: 16.

86 . The double stranded RNAi agent of claim 80 , further comprising a phosphate or phosphate mimic at the 5′-end of the antisense strand.

87 . (canceled)

88 . A double stranded RNAi agent for inhibiting expression of transthyretin (TTR) in a cell, wherein the RNAi agent comprises a sense strand and an antisense strand forming a double stranded region, wherein the sense strand comprises the nucleotide sequence 5′-usgsgga(Uhd)UfuCfAfUfguaaccaasgsa- 3′ of SEQ ID NO: 15 and the antisense strand comprises the nucleotide sequence 5′-VPusCfsuugGfuuAfcaugAfaAfucccasusc- 3′ of (SEQ ID NO: 17),

wherein a, c, g, and u are 2′-O-methyladenosine-3′-phosphate, 2′-O-methylcytidine-3′-phosphate, 2′-O-methylguanosine-3′-phosphate, and 2′-O-methyluridine-3′-phosphate, respectively; Af, Cf, Gf, and Uf are 2′-fluoroadenosine-3′-phosphate, 2′-fluorocytidine-3′-phosphate, 2′-fluoroguanosine-3′-phosphate, and 2′-fluorouridine-3′-phosphate, respectively; s is a phosphorothioate linkage; (Uhd) is 2′-O-hexadecyl-uridine-3′-phosphate; and VP is a vinyl phosphonate.

89 . A pharmaceutical composition comprising the double stranded RNAi agent of claim 4 .

90 . A method of inhibiting transthyretin (TTR) expression in an ocular cell, the method comprising:

contacting the cell with the double stranded RNAi agent of claim 4 , thereby inhibiting expression of the TTR gene in the ocular cell.

91 . The method of claim 90 , wherein the cell is within a subject,

and wherein the subject is a human.

92 . (canceled)

93 . (canceled)

94 . A method of treating a subject suffering from a TTR-associated ocular disease, comprising administering to the subject a therapeutically effective amount of a double stranded RNAi agent of claim 4 , thereby treating the subject.

95 . The method of claim 94 , wherein the TTR-associated ocular disease or disorder is selected from the group consisting of TTR-associated glaucoma, TTR-associated vitreous opacities, TTR-associated retinal abnormalities, TTR-associated retinal amyloid deposit, TTR-associated retinal angiopathy, TTR-associated iris amyloid deposit, TTR-associated scalloped iris, and TTR-associated amyloid deposits on lens.

96 - 104 . (canceled)

Assignments (1)
ASSIGNMENT OF ASSIGNOR'S INTEREST Recorded Aug 22, 2023
From: NAIR, JAYAPRAKASH K.; MAIER, MARTIN A.; JADHAV, VASANT R.; KEATING, MARK; FITZGERALD, KEVIN; MILSTEIN, STUART; BROWN, KIRK
To: ALNYLAM PHARMACEUTICALS, INC.
Reel/Frame 064663/0874 →