OLIGONUCLEOTIDES FOR TREATING EXPANDED REPEAT DISEASES
The invention provides for a method for selectively reducing the expression of a mutant mRNA and/or protein having an expanded nucleotide repeat relative to a wild-type mRNA, comprising contacting a cell with an antisense oligonucleotide of sufficient length and complementarity to the expanded nucleotide repeat. More particularly it relates to selectively reducing the expression of mutant Huntington protein associated with Huntington's disease. The antisense oligonucleotide comprising either a nucleotide or a repeated three nucleotide sequence as defined in the claims.
1 . An antisense oligonucleotide of 10-40 nucleotides in length having a nucleobase sequence complementary to an expanded DNA repeat which is associated with a human disease, wherein the antisense oligonucleotide comprises a nucleotide having a formula:
wherein Nu is a nucleobase;
wherein R 1 is NR 11 R 12 or OR 16 , wherein each of R 11 , R 12 , and R 16 is selected from hydrogen and C 1 -C 6 alkyl; or
R 1 is a moiety of the formula
q is 0, 1, 2, 3 or 4;
R 2 is selected from hydrogen, C1-C5 alkyl, and a formamidinyl moiety, and
R 3 is selected from hydrogen and C1-C5 alkyl, or
R 2 and R 3 are joined to form a 5-7 membered heterocyclic ring optionally containing an oxygen hetero atom, where the ring may be optionally substituted with a substituent selected from C1-C5 alkyl, phenyl, halogen, and aralkyl;
R 1 is selected from null, hydrogen, a C 1 -C 6 alkyl and aralkyl;
R x is selected from HO—, a nucleotide, a cell penetrating peptide moiety, and piperazinyl;
R y is selected from the group consisting of hydrogen, a C 1 -C 6 alkyl, a nucleotide, a cell penetrating peptide moiety, an amino acid, a formamidinyl moiety, and acyl; and, R z is selected from null, hydrogen, a C 1 -C 6 alkyl, and acyl; and
pharmaceutically acceptable salts thereof;
wherein the nucleobase sequence is selected from:
SEQ ID No. 1
(GAATAGAATAGAATAGAATAG);
SEQ ID No. 2
(GAATAGAATAGAATAGAATAGAATAG);
SEQ ID NO. 5
(CAGGCAGGCAGGCAGGCAGG);
SEQ ID No. 6
(CAGGCAGGCAGGCAGGCAGGCAGGCAG);
SEQ ID No. 13
(CAGGCCCAGGCCCAGGCCCAGGCC);
SEQ ID No. 14
(CAGGCCCAGGCCCAGGCCCAGGCCCAGGCC);
SEQ ID No. 15
(GGCCCCGGCCCCGGCCCCGGCCCC);
SEQ ID No. 16
(GGCCCCGGCCCCGGCCCCGGCGGCCCCGGC);
SEQ ID No. 17
(CCATTCCATTCCATTCCATTCC);
SEQ ID No. 18
(CCATTCCATTCCATTCCATTCCATTCC);
SEQ ID No. 21
(GCTGCTGCTGCTGCTGCTGCTG);
SEQ ID No. 22
(GCTATTACCTTAACCCAG);
and
SEQ ID No. 24
(GGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCC
CCGGCCCCGGCCCCGGCCCC).
2 . (canceled)
3 . (canceled)
4 . (canceled)
5 . (canceled)
6 . (canceled)
7 . (canceled)
8 . The antisense oligonucleotide of claim 1 , wherein the human disease is selected from amyotrophic lateral sclerosis (ALS), myotonic dystrophy type 1, and myotonic dystrophy type 2.
9 . (canceled)
10 . (canceled)
11 . A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 and a pharmaceutically acceptable carrier.
12 . A method of treating amyotrophic lateral sclerosis (ALS). myotonic dystrophy type 1, or myotonic dystrophy type 2 in a subject comprising administering the composition of claim 11 .
13 . An antisense oligonucleotide comprising a repeated three nucleotide sequence having the formula:
wherein:
Nu 1 , Nu 2 and Nu 3 are nucleobases selected from adenine, guanine, thymine, uracil, cytosine, and hypoxanthine;
n is from about 3 to about 10 representing the number of repeats of the nucleotide sequence (Nu 5 , Nu 2 , Nu 3 );
wherein R 1 is NR 11 R 12 or OR 16 , wherein each of R 11 , R 12 , and R 16 is selected from hydrogen and C 1 -C 6 alkyl; or
R 1 is a moiety of the formula
q is 0, 1, 2, 3 or 4;
R 2 is selected from hydrogen, C1-C5 alkyl, and a formamidinyl moiety, and
R 3 is selected from hydrogen and C1-C5 alkyl, or
R 2 and R 3 are joined to form a 5-7 membered heterocyclic ring optionally containing an oxygen hetero atom, where the ring may be optionally substituted with a substituent selected from the group consisting of C1-C5 alkyl, phenyl, halogen, and aralkyl;
R 1 is selected from null, hydrogen, a C 1 -C 6 alkyl and aralkyl;
R x is selected from HO—, a nucleotide, a cell penetrating peptide moiety, and piperazinyl;
R y is selected from hydrogen, a C 1 -C 6 alkyl, a nucleotide, a cell penetrating peptide moiety, an amino acid, a formamidinyl moiety, and acyl; and,
R z is selected from null, hydrogen, a C 1 -C 6 alkyl, and acyl; or pharmaceutically acceptable salts thereof;
wherein the sequence is selected from:
SEQ ID No. 1
(GAATAGAATAGAATAGAATAG);
SEQ ID No. 2
(GAATAGAATAGAATAGAATAGAATAG);
SEQ ID NO. 5
(CAGGCAGGCAGGCAGGCAGG);
SEQ ID No. 6
(CAGGCAGGCAGGCAGGCAGGCAGGCAG);
SEQ ID No. 13
(CAGGCCCAGGCCCAGGCCCAGGCC);
SEQ ID No. 14
(CAGGCCCAGGCCCAGGCCCAGGCCCAGGCC);
SEQ ID No. 15
(GGCCCCGGCCCCGGCCCCGGCCCC);
SEQ ID No. 16
(GGCCCCGGCCCCGGCCCCGGCGGCCCCGGC);
SEQ ID No. 17
(CCATTCCATTCCATTCCATTCC);
SEQ ID No. 18
(CCATTCCATTCCATTCCATTCCATTCC);
SEQ ID No. 21
(GCTGCTGCTGCTGCTGCTGCTG);
SEQ ID No. 22
(GCTATTACCTTAACCCAG);
and
SEQ ID No. 24
(GGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCCCCGGCC
CCGGCCCCGGCCCCGGCCCC).
14 . (canceled)
15 . (canceled)
16 . (canceled)
17 . (canceled)
18 . A pharmaceutical composition comprising the antisense oligonucleotide of claim 13 and a pharmaceutically acceptable carrier.
19 . A method of treating amyotrophic lateral sclerosis (ALS). myotonic dystrophy type 1, or myotonic dystrophy type 2 in a subject comprising administering the pharmaceutical composition of claim 18 to the subject.
20 . (canceled)
21 . The antisense oligonucleotide of claim 1 , or pharmaceutically acceptable salts thereof, wherein R 1 is NR 11 R 12 ; and
wherein each of R 11 and R 12 are selected from hydrogen and C 1 -C 6 alkyl.
22 . The antisense oligonucleotide of claim 1 , or pharmaceutically acceptable salts thereof, wherein R 1 is —N(Me) 2 .
23 . The antisense oligonucleotide of claim 13 , or pharmaceutically acceptable salts thereof, wherein R 1 is NR 11 R 12 ; and
wherein each of R 11 and R 12 are selected from hydrogen and C 1 -C 6 alkyl.
24 . The antisense oligonucleotide of claim 13 , or pharmaceutically acceptable salts thereof, wherein R 1 is —N(Me) 2 .