FORMULATION OF AN ANTISENSE OLIGOMER CONJUGATE
Provided herein are pharmaceutical compositions comprising benzyl alcohol and an antisense oligomer conjugate of formula (1): Also provided herein are methods of treating progeroid diseases, such as Hutchinson-Gilford progeria syndrome (HGPS), in a subject in need thereof, comprising administering to the subject a pharmaceutical composition as described herein.
1 . A pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula (I):
or a pharmaceutically acceptable salt thereof,
wherein:
A′ is selected from —OH,
wherein
R 5 is —C(O)(O-alkyl) x -OH, wherein x is 3-10 and each alkyl group is, independently at each occurrence, C 2-6 -alkyl,
or R 5 is selected from —H, —C(O)C 1-6 -alkyl, trityl, monomethoxytrityl, —(C 1-6 -alkyl)-R 6 , —(C 1-6 -heteroalkyl)-R 6 , —C 6-10 -aryl-R 6 , 5- to 10-membered heteroaryl-R 6 , —C(O)O—(C 1-6 -alkyl)-R 6 , —C(O)O—(C 6-10 -aryl)-R 6 , —C(O)O-(5- to 10-membered heteroaryl)-R 6 , and
R 6 is selected from —OH, —SH, and —NH 2 , or R 6 is O, S, or NH, each of which is covalently linked to a solid support;
R 9 is C 1-6 -alkyl;
each R 1 is independently selected from —OH and —N(R 3 )(R 4 ), wherein each R 3 and R 4 is, independently at each occurrence, —H or —C 1-6 -alkyl;
each R 2 is independently, at each occurrence, selected from —H, a nucleobase, and a nucleobase functionalized with a chemical protecting group, wherein the nucleobase and the nucleobase functionalized with a chemical protecting group, independently at each occurrence, comprise a ring selected from pyridine, pyrimidine, purine, and deaza-purine;
t is 8-40;
E′ is selected from —H, —C 1-6 -alkyl, —C(O)C 1-6 -alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl,
wherein
Q is —C(O)(CH 2 ) 6 C(O)— or —C(O)(CH 2 ) 2 S 2 (CH 2 ) 2 C(O)—;
R 7 is —(CH 2 ) 2 OC(O)N(R 8 ) 2 , wherein R 8 is —(CH 2 ) 6 NHC(═NH)NH 2 ;
L is a linking amino acid, wherein L is covalently linked by an amide bond to the N-terminus or C-terminus of J;
J is a cell-penetrating peptide;
G is selected from —H, —C(O)C 1-6 -alkyl, benzoyl, and stearoyl, wherein G is covalently linked to J; and
wherein at least one of the following is true:
(1) A′ is
or (2) E′ is
2 . The pharmaceutical composition of claim 1 , wherein E′ is selected from —H, —C 1-6 -alkyl, —C(O)C 1-6 -alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, and
3 . (canceled)
4 . The pharmaceutical composition according to claim 1 , wherein A′ is selected from:
5 - 7 . (canceled)
8 . The pharmaceutical composition according to claim 1 , wherein L is glycine, proline, or β-alanine.
9 - 11 . (canceled)
12 . The pharmaceutical composition according to claim 1 , wherein J is selected from SEQ ID NOS: 5-21.
13 . The pharmaceutical composition according to claim 1 , wherein G is selected from —H, —C(O)CH 3 , benzoyl, and stearoyl.
14 - 16 . (canceled)
17 . The pharmaceutical composition according to any ene of claim 1 , wherein each R 2 is a nucleobase, and all R 2 groups taken together form a targeting sequence; wherein the targeting sequence is selected from:
SEQ ID NO: 3
(CTGAGCCGCTGGCAGATGCCTTGTC) wherein t is 23;
and
SEQ ID NO: 4
(GAGGAGATGGGTCCACCCACCTGGG) wherein t is 23.
18 . The pharmaceutical composition according to claim 1 , wherein the antisense oligomer conjugate is of formula (IA):
or a pharmaceutically acceptable salt thereof, wherein:
A′ is a moiety selected from:
19 . The pharmaceutical composition according to claim 1 , wherein the antisense oligomer conjugate is of formula (II):
or a pharmaceutically acceptable salt thereof.
20 . The pharmaceutical composition according to claim 1 , wherein the antisense oligomer conjugate is an HCl salt.
21 . (canceled)
22 . The pharmaceutical composition according to claim 1 , wherein the antisense oligomer conjugate is of Formula (IIA):
wherein n is 9-39.
23 . (canceled)
24 . The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition further comprises one or more of histidine, citrate, mannitol, propylene glycol, glycerin, arginine, lysine, tryptophan, or phenol.
25 . (canceled)
26 . The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition has a pH range of 6.0 to 7.0.
27 . (canceled)
28 . The pharmaceutical composition according to claim 1 , wherein the composition comprises 2% weight by volume of benzyl alcohol and the composition has a pH of 6.5.
29 . (canceled)
30 . The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition further comprises histidine and propylene glycol.
31 . The pharmaceutical composition according to claim 30 , wherein the composition comprises 2% weight by volume of benzyl alcohol, 2-3% weight by volume of propylene glycol, and the composition has a pH of 6.5.
32 . (canceled)
33 . The pharmaceutical composition according to claim 1 , wherein the pharmaceutical composition further comprises histidine and mannitol.
34 . The pharmaceutical composition according to claim 33 , wherein the composition comprises 2% weight by volume of benzyl alcohol, 5% weight by volume of mannitol, and the composition has a pH of 6.5.
35 . (canceled)
36 . The pharmaceutical composition according to claim 22 , wherein the targeting sequence is selected from:
SEQ ID NO: 3
(CTGAGCCGCTGGCAGATGCCTTGTC),
and
n is 24;
and
SEQ ID NO: 4
(GAGGAGATGGGTCCACCCACCTGGG),
and
n is 24.
37 - 40 . (canceled)
41 . A method for treating Hutchinson-Gilford progeria syndrome (HGPS) in a subject in need thereof comprising administering to the subject the pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of formula (I);
or a pharmaceutically acceptable salt thereof,
wherein:
A′ is selected from —OH,
wherein
R 5 is —C(O)(O-alkyl) x -OH, wherein x is 3-10 and each alkyl group is, independently at each occurrence, C 2-6 -alkyl,
or R 5 is selected from —H, —C(O)C 1-6 -alkyl, trityl, monomethoxytrityl, —(C 1-6 -alkyl)-R 6 , —(C 1-6 -heteroalkyl)-R 6 , —C 6-10 -aryl-R 6 , 5- to 10-membered heteroaryl-R 6 , —C(O)O—(C 1-6 -alkyl)-R 6 , —C(O)O—(C 6-10 -aryl)-R 6 , —C(O)O-(5- to 10-membered heteroaryl)-R 6 , and
R 6 is selected from —OH, —SH, and —NH 2 , or R 6 is O, S, or NH, each of which is covalently linked to a solid support;
R 9 is C 1-6 -alkyl;
each R 1 is independently selected from —OH and —N(R 3 )(R 4 ), wherein each R 3 and R 4 is, independently at each occurrence, —H or —C 1-6 -alkyl:
each R 2 is independently, at each occurrence, selected from —H, a nucleobase, and a nucleobase functionalized with a chemical protecting group, wherein the nucleobase and the nucleobase functionalized with a chemical protecting group, independently at each occurrence, comprise a ring selected from pyridine, pyrimidine, purine, and deaza-purine;
t is 8-40;
E′ is selected from —H, —C 1-6 -alkyl, —C(O)C 1-6 -alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl,
wherein
Q is —C(O)(CH 2 ) 6 C(O)— or —C(O)(CH 2 ) 2 S 2 (CH 2 ) 2 C(O)—;
R 7 is —(CH 2 ) 2 OC(O)N(R 8 ) 2 , wherein R 8 is —(CH 2 )(NHC(═NH)NH 2 ;
L is a linking amino acid, wherein L is covalently linked by an amide bond to the N-terminus or C-terminus of J;
J is a cell-penetrating peptide;
G is selected from —H, —C(O)C 1-6 -alkyl, benzoyl, and stearoyl, wherein G is covalently linked to J; and
wherein at least one of the following is true;
(1) A′ is
or (2) E′ is