RNAi agents for inhibiting expression of complement factor B (CFB), pharmaceutical compositions thereof, and methods of use
The present disclosure relates to RNAi agents able to inhibit Complement Factor B (CFB) gene expression. Also disclosed are pharmaceutical compositions that include CFB RNAi agents and methods of use thereof. The CFB RNAi agents disclosed herein may be conjugated to targeting ligands, including ligands that comprise N-acetyl-galactosanine, to facilitate the in vivo delivery to hepatocyte cells. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms mediated in part by CFB gene expression, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), Anti-Glomerular Basement Membrane disease (anti-GBM), ischemia reperfusion injury and T-cell mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and/or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and/or other complement-mediated diseases.
1. An RNAi agent for inhibiting expression of a complement factor B (CFB) gene, comprising:
an antisense strand wherein nucleotides 1-21 of the antisense strand (5′→3′) comprise the nucleotide sequence (5′→3′): UAAGUACUCAGACACUACAGC (SEQ ID NO:1332);
and a sense strand that comprises the nucleotide sequence (5′→3′): GCUGUGGUGUCUGAGUACUUA (SEQ ID NO:1406); wherein all of the nucleotides of the antisense strand and all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides and 2′-O-methyl modified nucleotides, wherein the sense strand is covalently linked to a targeting ligand that comprises N-acetyl-galactosamine.
2. The RNAi agent of claim 1 , wherein the targeting ligand is linked to the 5′ terminal end of the sense strand.
3. The RNAi agent of claim 1 , wherein the targeting ligand comprises:
4. The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
5. The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
6. The RNAi agent of claim 1 , wherein the sense strand comprises one or two inverted abasic residues.
7. The RNAi agent of claim 1 , comprising an antisense strand that comprises the modified nucleotide sequence (5′→3′): usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; and s represents a phosphorothioate linkage.
8. The RNAi agent of claim 7 , wherein the sense strand comprises the modified nucleotide sequence (5′→3′): gcugugguGfUfCfugaguacuua (SEQ ID NO:1235); wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine.
9. The RNAi agent claim 8 , wherein the sense strand further includes inverted abasic residues at the 3′ terminal end of the nucleotide sequence, at the 5′ end of the nucleotide sequence, or at both.
10. The RNAi agent of claim 1 , wherein the antisense strand comprises the modified nucleotide sequence (5′→3′): usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO:1013); and the sense strand comprises the modified nucleotide sequence (5′→3′): (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO:1136); wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af, represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage; (invAb) represents an inverted abasic deoxyribonucleotide; and (NAG37)s represents the following chemical structure:
11. The RNAi agent of claim 1 , wherein the RNAi agent is a pharmaceutically acceptable salt.
12. The RNAi agent of claim 11 , wherein the RNAi agent is a sodium salt.
13. The RNAi agent of claim 10 , wherein the RNAi agent is a pharmaceutically acceptable salt.
14. The RNAi agent of claim 13 , wherein the RNAi agent is a sodium salt.
15. A pharmaceutical composition comprising the RNAi agent of claim 1 , wherein the composition comprises a pharmaceutically acceptable excipient.
16. A pharmaceutical composition comprising the RNAi agent of claim 10 , wherein the composition comprises a pharmaceutically acceptable excipient.
17. A pharmaceutical composition comprising the RNAi agent of claim 13 , wherein the composition comprises a pharmaceutically acceptable excipient.
18. The pharmaceutical composition of claim 17 , wherein the pharmaceutically acceptable excipient is isotonic saline.
19. The pharmaceutical composition of claim 17 , wherein the pharmaceutically acceptable excipient is water for injection.