Method for the isolation of double-strand breaks
View Patent ↗The invention relates to a method for determining the number and nature of DNA double-strand breaks (DSBs) in a nucleic acid sample, ideally gDNA; a kit of parts for performing the method including at least a plurality of oligonucleotides for ligating to the nucleic acid sample and providing at least a first hybridization site (RD1 SP or RD2 SP) to which at least one read sequencing primer can hybridise; and oligonucleotides for use in the kit and method.
1. A method of sample preparation for identifying DNA double-strand breaks (DSBs) in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be capable of binding to a substrate comprising at least a first immobilised primer, the method comprising:
a) providing a sample comprising a plurality of nucleic acids;
b) exposing the plurality of nucleic acids to a first adaptor pair under conditions conducive to ligation, wherein the first adaptor pair comprises first and second oligonucleotides that are at least partially complementary to each other, and the first oligonucleotide is ligatable to a 3′ terminus of a strand of a DSB and comprises a sequence that is capable of binding to the first immobilised primer by hybridisation;
c) fragmenting the plurality of nucleic acids; and
d) exposing the plurality of nucleic acids to a second adaptor pair under conditions conducive to ligation, wherein the second adaptor pair is capable of being ligated to at least a 5′ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adaptor pair, wherein the second adaptor pair comprises first and second oligonucleotides that are partially complementary to each other, and the first oligonucleotide is ligatable to a 5′ terminus and comprises a sequence identical to a region of a second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer.
2. The method of claim 1 , wherein the method comprises modification of the DSB-associated nucleic acids to be capable of amplification, wherein the amplification comprises the use of the first immobilised primer and the second primer.
3. The method of claim 1 , wherein
the second primer is a second immobilised primer comprised by the substrate.
4. The method of claim 3 , wherein the method comprises modification of the DSB-associated nucleic acids to be capable of amplification, wherein the amplification comprises the use of the first immobilised primer and the second immobilised primer.
5. The method of claim 4 , wherein the amplification is bridge amplification.
6. The method of claim 1 , wherein the second adaptor pair comprises the first oligonucleotide comprising a sequence according to CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32), and the second oligonucleotide comprising a sequence that does not comprise a sequence of more than 5, 10, 15, or 20 bases, or does not comprise all 24 bases, of the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30).
7. The method of claim 1 , wherein the second adaptor pair comprises the first oligonucleotide comprising a sequence according to AATGATACGGCGACCACCGA (SEQ ID NO: 34), and the second oligonucleotide comprising a sequence that does not comprise a sequence of more than 5, 10, or 15 bases, or does not comprise all 20 bases, of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31).
8. The method of claim 1 , wherein the first oligonucleotide of the first adaptor pair comprises a 3′ protective feature; and/or wherein the second oligonucleotide of the second adaptor pair comprises a 3′ protective feature.
9. The method of claim 1 , wherein the second adaptor pair is not capable of being ligated to the first adaptor pair due to the presence of a 3′ modification of the first adaptor pair.
10. The method of claim 1 , wherein the oligonucleotide of the second adaptor pair that is ligatable to a 5′ terminus comprises a sequence identical to 5, 10, 15, 20, 21, 24, or more bases of the second primer.
11. The method of claim 1 , further comprising denaturing the plurality of nucleic acids to form a plurality of single-stranded nucleic acids.
12. The method of claim 1 , further comprising contacting the plurality of nucleic acids with the substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids.
13. The method of claim 12 , further comprising obtaining sequence information for any nucleic acids hybridised to the substrate.
14. The method of claim 1 , wherein said sample comprising a plurality of nucleic acids is genomic DNA (gDNA).
15. The method of claim 1 , wherein the steps are performed in the order a), b), c), and then d).
16. The method of claim 15 , wherein the sample is exposed to conditions capable of causing a DSB at a feature in the nucleic acid sample prior to step b).
17. The method of claim 1 , wherein the steps are performed in the order a), c), d), and then b), wherein the sample is exposed to conditions capable of causing or suspected of being capable of causing a DSB between steps d) and b).
18. The method of claim 17 , wherein the sample is exposed to conditions capable of causing a DSB at a feature in the nucleic acid sample.
19. The method of claim 1 , wherein said ligation in step b) occurs in situ or in vitro using a cell or tissue sample.
20. The method of claim 1 , wherein the first adaptor pair comprises a first hybridization site to which a first sequencing primer can bind and/or the second adaptor pair comprises a second hybridization site to which a second sequencing primer can bind.