DOSING OF MUSCLE TARGETING COMPLEXES FOR TREATING DYSTROPHINOPATHIES
Aspects of the disclosure relate to methods of promoting expression or activity of a dystrophin protein and/or methods of treating DMD in a subject. In some embodiments, the methods comprise administering to the subject a composition comprising complexes (e.g., muscle targeting complexes) comprising a phosphorodiamidate morpholino oligomer (e.g., useful for targeting DMD) covalently linked to an antibody (e.g., anti-TfR1 antibody).
1 . A method of promoting expression or activity of a dystrophin protein or treating Duchenne Muscular Dystrophy (DMD) in a subject, comprising administering to the subject a composition comprising an effective amount of complexes, each complex comprising an anti-transferrin receptor 1 (TfR1) antibody covalently linked to one or more oligonucleotides, wherein the effective amount provides to the subject 1 mg to 90 mg of the anti-TfR1 antibody of the complexes per kg of the subject, wherein the antibody comprises: a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as set forth in SEQ ID NOs: 1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as set forth in SEQ ID NOs: 2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as set forth in SEQ ID NOs: 3, 9, or 14, a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as set forth in SEQ ID NOs: 4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as set forth in SEQ ID NOs: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as set forth in SEQ ID NOs: 6 or 16, wherein the oligonucleotide comprises the nucleotide sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21) and is a phosphorodiamidate morpholino oligomer (PMO).
2 . The method of claim 1 , wherein each complex comprises a structure of formula (I): [R 1 ] n1-R 2 , wherein:
each R 1 comprises a group of the formula (Ib):
in which -pN indicates a base position of a phosphorodiamidate morpholino oligomer (PMO), wherein -p reflects a phosphorodiamidate linkage, and wherein N corresponds to a nucleobase of adenine (A), cytosine (C), guanine (G), or thymine (T), such that the PMO has a base sequence of CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 21);
R 2 comprises the anti-TfR1 antibody; and
in each complex, n1 is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfR1 antibody, optionally wherein the average value of n1 of the complexes of the composition is in the range of 1 to 5.
3 . The method of claim 1 or claim 2 , wherein each complex comprises a structure of formula (I): [R 1 ] n1 —R 2 , wherein:
each R 1 comprises a group of the formula (Ic):
R 2 comprises the anti-TfR1 antibody; and
in each complex, n1 is independently an integer of one or greater representing the number of instances of R 1 , wherein each instance of R 1 is covalently linked via attachment point A to a different lysine of the anti-TfR1 antibody, optionally wherein the average value of n1 of the complexes of the composition is in the range of 1 to 5.
4 . The method of any one of claims 1-3 , wherein the anti-TfR1 antibody is a Fab fragment.
5 . The method of any one of claims 1-4 , wherein the anti-TfR1 antibody comprises a heavy chain variable region (VH) comprising the amino acid sequence of SEQ ID NO: 17 and a light chain variable region (VL) comprising the amino acid sequence of SEQ ID NO: 18.
6 . The method of any one of claims 1-5 , wherein the anti-TfR1 antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and a light chain comprising the amino acid sequence of SEQ ID NO: 20.
7 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 1-8 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
8 . The method of any one of claims 1-7 , wherein the effective amount of each administration provides to the subject 1-2 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 1.5 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
9 . The method of any one of claims 1-7 , wherein the effective amount of each administration provides to the subject 2-4 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 3 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
10 . The method of any one of claims 1-7 , wherein the effective amount of each administration provides to the subject 4-8 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 6 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
11 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 3-52 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 5-40 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
12 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 7-15 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 11 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
13 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 15-30 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 22 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
14 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 30-59 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 44 mg of the anti-TfR1 antibody of the complexes per kg of the subject.
15 . The method of any one of claims 1-6 , wherein the effective amount of each administration provides to the subject 61-117 mg of the anti-TfR1 antibody of the complexes per kg of the subject, optionally wherein the effective amount of each administration provides to the subject 88 mg of the anti-TfR1 antibody of the complexes per kg of the subject
16 . The method of any one of claims 1-15 , wherein the composition is administered once every 2 weeks, once every 4 weeks, once every 8 weeks or once every 12 weeks.
17 . The method of any one of claims 1-16 , wherein the composition is administered once every 4 weeks.
18 . The method of any one of claims 1-16 , wherein the composition is administered once every 8 weeks.
19 . The method of any one of claims 1-18 , wherein the composition is in an aqueous solution and further comprises histidine and sucrose, optionally wherein the histidine is present in the aqueous solution at a concentration of 25 mM, optionally wherein the sucrose is present in the aqueous solution at a concentration of 10 w/v %, and optionally wherein the aqueous solution is at a pH of 6.0.
20 . The method of any one of claims 1-19 , wherein the subject has a mutated dystrophin allele comprising a mutation amenable to exon 51 skipping or the mutated dystrophin allele comprises a frameshift mutation in exon 51.
21 . The method of any one of claims 1-20 , wherein the complex promotes expression or activity of a truncated dystrophin protein in the subject.
22 . The method of any one of claims 1-21 , wherein the subject is a human subject, optionally wherein the human subject is between 2-60 years of age.