COMPOSITIONS AND METHODS FOR THE TREATMENT OF SPINAL MUSCULAR ATROPHY (SMA)
The invention of the disclosure features compositions and methods for treating spinal muscular atrophy (SMA) by introducing alterations to a survival of motor neuron 2 (SMN2) polynucleotide(s) in a cell. In particular embodiments, the invention provides a base editor system (e.g., a fusion protein or complex comprising a programmable DNA binding protein, a nucleobase editor, and gRNA) for modifying an SMN2 polynucleotide(s), where the alteration is associated with increased expression of the SMN2 polypeptide(s) encoded by the polynucleotide(s).
1 . A method of editing a nucleobase of a survival of motor neuron 2 (SMN2) polynucleotide, the method comprising contacting the SMN2 polynucleotide with a guide polynucleotide and a base editor comprising a fusion protein or a protein complex comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and a deaminase domain, wherein said guide polynucleotide targets said base editor to effect an alteration of the nucleobase of the SMN2 polynucleotide.
2 . The method of claim 1 , wherein the SMN2 polynucleotide is in a motor neuron or fibroblast, and wherein the cell is in vivo or in vitro.
3 . A method of treating spinal muscular atrophy (SMA) in a subject in need thereof, the method comprising contacting a cell of the subject with a base editor comprising a fusion protein or protein complex comprising a nucleic acid programmable DNA binding protein (napDNAbp) domain and a deaminase domain, or a polynucleotide encoding the base editor, and one, two, or more guide polynucleotide(s), or polynucleotide(s) encoding the guide polynucleotide(s), that target the base editor to effect an alteration of a survival of motor neuron 2 (SMN2) polynucleotide, thereby treating SMA in the subject.
4 . The method of claim 1 , wherein the guide polynucleotide(s) comprises a nucleic acid sequence comprising at least 10 contiguous nucleotides of a spacer nucleic acid sequence listed in Table 2A or Table 2C.
5 . The method of claim 4 , wherein the guide polynucleotide comprises the nucleotide sequence ACUCCUUAAUUUAAGGAAUG (SEQ ID NO: 562; gRNA1962); GACAAAAUCAAAAAGAAGGA (SEQ ID No: 514; gRNA1973); UUAAGGAGUAAGUCUGCCAG (SEQ ID NO: 626; gRNA2349); UGCUCACAUUCCUUAAAUUA (SEQ ID NO: 574; gRNA1974); GCAGACUUACUCCUUAAUUUA (SEQ ID NO: 576; gRNA1976); or UCACAUUCCUUAAAUUAAGGA (SEQ ID NO: 592; gRNA1992).
6 . The method of any one of claim 1 , wherein the guide polynucleotide comprises a scaffold comprising the nucleotide sequence:
SpCas9 scaffold
(SEQ ID NO: 317)
GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA
CUUGAAAAAGUGGCACCGAGUCGGUGCUUUU;
or
SaCas9 scaffold
(SEQ ID NO: 425)
GUUUUAGUACUCUGUAAUGAAAAUUACAGAAUCUACUAAAACAAGGCAA
AAUGCCGUGUUUAUCUCGUCAACUUGUUGGCGAGAUUUU.
7 . The method of claim 1 , wherein the guide polynucleotide comprises the sequence
(SEQ ID NO: 503; gRNA1962)
ACUCCUUAAUUUAAGGAAUGGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU
UU;
(SEQ ID NO: 514; gRNA1973)
GACAAAAUCAAAAAGAAGGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU
UU;
(SEQ ID NO: 630; gRNA2349)
UUAAGGAGUAAGUCUGCCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU
UU;
(SEQ ID NO: 515; gRNA1974)
UGCUCACAUUCCUUAAAUUAGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUU
UU;
(SEQ ID NO: 517; gRNA1976)
GCAGACUUACUCCUUAAUUUAGUUUUAGUACUCUGUAAUGAAAAUUACA
GAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUU
GGCGAGAUUUU;
or
(SEQ ID NO: 533; gRNA1992)
UCACAUUCCUUAAAUUAAGGAGUUUUAGUACUCUGUAAUGAAAAUUACA
GAAUCUACUAAAACAAGGCAAAAUGCCGUGUUUAUCUCGUCAACUUGUU
GGCGAGAUUUU.
8 . The method of claim 1 , wherein alteration of the nucleobase is associated with an increase in full-length polynucleotides encoding the SMN2 polypeptide transcribed from the SMN2 polynucleotide; and/or wherein alteration of a nucleobase in the SMN2 polynucleotide results in an increase in the number of transcripts transcribed from the SMN2 polynucleotide that include Exon 7.
9 . The method of claim 1 , wherein the altered nucleobase in the SMN2 polynucleotide is associated with an alteration in splicing; and/or wherein the alteration is associated with an increase in levels of a survival motor neuron (SMN) polypeptide in a cell.
10 . The method of claim 1 , wherein the alteration is selected from the group consisting of a C10 alteration in Intron 7 of the SMN2 polynucleotide, a C7 alteration in Intron 7 of the SMN2 polynucleotide, a C11 alteration in Intron 7 of the SMN2 polynucleotide, a T6C alteration in Exon 7 of the SMN2 polynucleotide, and a A54G alteration in Exon 7 of the SMN2 polynucleotide.
11 . The method of claim 1 , wherein the napDNAbp domain comprises a Cas9, Cas12a/Cpf1, Cas12b/C2c1, Cas12c/C2c3, Cas12d/CasY, Cas12e/CasX, Cas12g, Cas12h, Cas12i, or Cas12j/CasΦ polynucleotide or a portion thereof,
wherein the napDNAbp domain comprises a dead Cas9 (dCas9) or a Cas9 nickase (nCas9);
wherein the napDNAbp domain is a modified Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1 Cas9 (St1Cas9), a modified Streptococcus pyogenes Cas9 (SpCas9), or variants thereof,
wherein the napDNAbp domain comprises a variant of SpCas9 having an altered protospacer-adjacent motif (PAM) specificity;
wherein the cytidine deaminase domain is an APOBEC deaminase domain or a derivative thereof;
wherein the adenosine deaminase domain is TadA deaminase domain;
wherein the napDNAbp domain further comprises one or more uracil glycosylase inhibitors (UGIs); and/or
wherein the napDNAbp domain further comprises one or more nuclear localization sequences (NLS).
12 . The method of claim 3 , wherein contacting the cell involves administering a polynucleotide to the subject or a vector comprising the polynucleotide, wherein the polynucleotide encodes the base editor, or a component thereof, and/or the guide polynucleotide.
13 . The method of claim 12 , wherein the vector is a lipid nanoparticle.
14 . The method of claim 13 , wherein the vector is an AAV9 vector or an AAV-PHP.B vector.
15 . A modified cell comprising an alteration in a nucleobase of a survival of motor neuron 2 (SMN2) polynucleotide, wherein the alteration increases expression and/or activity of the encoded SMN2 polypeptide as compared to a control cell without the alteration.
16 . A base editor system comprising a fusion protein or a polynucleotide encoding the fusion protein, wherein the fusion protein comprises a nucleic acid programmable DNA binding protein (napDNAbp) domain, a deaminase domain, and a guide polynucleotide comprising a spacer sequence selected from Table 2A or Table 2C.
17 . A polynucleotide encoding the base editor system of claim 16 , or a component thereof.
18 . A vector comprising the polynucleotide of claim 17 .
19 . A cell produced by the method of claim 3 .
20 . A kit comprising a base editor system comprising a fusion protein or a polynucleotide encoding the fusion protein, wherein the fusion protein comprises a nucleic acid programmable DNA binding protein (napDNAbp) domain, a deaminase domain, and a guide polynucleotide comprising a spacer selected from Table 2A or Table 2C.
21 . A pharmaceutical composition comprising an effective amount of a base editor system comprising a fusion protein or a polynucleotide encoding the fusion protein, wherein the fusion protein comprises a nucleic acid programmable DNA binding protein (napDNAbp) domain, a deaminase domain, and a guide polynucleotide comprising a spacer selected from Table 2A or Table 2C.
22 . A guide polynucleotide comprising a sequence listed in Tables 2A-2C.