RNAi agents for inhibiting expression of inhibin subunit beta E (INHBE), pharmaceutical compositions thereof, and methods of use
The present disclosure relates to RNAi agents, e.g., double stranded RNAi agents such as siRNAs, able to Inhibin Subunit Beta E (INHBE) gene expression. Also disclosed are pharmaceutical compositions that include INHBE RNAi agents and methods of use thereof. The INHBE RNAi agents disclosed herein may be conjugated to targeting ligands to facilitate the delivery to cells, including to hepatocytes. Delivery of the INHBE RNAi agents in vivo provides for inhibition of INHBE gene expression. The RNAi agents can be used in methods of treatment of diseases, disorders, or symptoms mediated in part by INHBE gene expression, such as obesity, diabetes, liver inflammation, dyslipidemia, or metabolic disease.
1 . An RNAi agent for inhibiting expression of an Inhibin Subunit Beta E (INHBE) gene, comprising:
an antisense strand wherein nucleotides 1-21 of the antisense strand 5′→3′) comprise the nucleotide sequence (5′→3′): usAfsuuAfagaaagUfaUfaAfgccassg (SEQ ID NO: 391), wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, and u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage, and ss represents a phosphorodithioate linkage; and
a sense strand comprising the nucleotide sequence (5′→3′): CUGGCUUAUACUUUCUUAAUA (SEQ ID NO: 684);
wherein all of the nucleotides of the sense strand are modified nucleotides, wherein the modified nucleotides are selected from the group consisting of 2′-fluoro modified nucleotides and 2′-O-methyl modified nucleotides.
2 . The RNAi agent of claim 1 , comprising a targeting ligand linked to the 5′ terminal end of the sense strand.
3 . The RNAi agent of claim 1 , wherein the RNAi agent comprises:
4 . The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each between 21 and 24 nucleotides in length.
5 . The RNAi agent of claim 1 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
6 . The RNAi agent of claim 1 , wherein the sense strand comprises one or two inverted abasic residues.
7 . The RNAi agent of claim 1 , wherein the sense strand comprises the modified nucleotide sequence (5′→3′): (NAG37)s(invAb)scuggcuuaUfaCfUfuucuuaauas(invAb) (SEQ ID NO: 515);
wherein a represents 2′-O-methyl adenosine, c represents 2′-O-methyl cytidine, g represents 2′-O-methyl guanosine, u represents 2′-O-methyl uridine; Af represents 2′-fluoro adenosine, Cf represents 2′-fluoro cytidine, Gf represents 2′-fluoro guanosine, and Uf represents 2′-fluoro uridine; s represents a phosphorothioate linkage, ss represents a phosphorodithioate linkage; (invAb) represents an inverted abasic deoxyribonucleotide; and (NAG37)s represents the following chemical structure:
8 . The RNAi agent of claim 7 , wherein the RNAi agent is a pharmaceutically acceptable salt.
9 . The RNAi agent of claim 8 , wherein the RNAi agent is a sodium salt.
10 . A pharmaceutical composition comprising the RNAi agent of claim 7 , wherein the composition comprises a pharmaceutically acceptable excipient.
11 . The pharmaceutical composition of claim 10 , wherein the pharmaceutically acceptable excipient is isotonic saline.
12 . The pharmaceutical composition of claim 11 , wherein the pharmaceutically acceptable excipient is water for injection.
13 . A method of inhibiting expression of an Inhibin Subunit Beta E (INHBE) gene in a cell, the method comprising introducing into the cell an effective amount of a therapeutically effective amount of the pharmaceutical composition of claim 10 .
14 . The method of claim 13 , wherein the cell is within a subject.
15 . The method of claim 14 , wherein the cell is within a human subject.
16 . The method of claim 15 , wherein the INHBE gene expression is inhibited by at least 30%.